- ntg-context - Mailing Lists

\definehead behaving differently when in an environment file versus \input'ed
by ntg＠scorecrow.com 02 May '20

02 May '20

I'm having trouble with \definehead behaving differently depending upon whether I process a file that includes it via a \input statement versus a project structure that calls it via an environment file referenced from a component file. Overall aim: I currently produce a small circulation journal in Word that I'm hoping to switch to ConTeXt. Each article is written by a different author and I currently provide a Word template so they can see how their article will eventually look and how long it is, etc. I want to do the same for the ConTeXt version so I have created a template tex file they can simply \input at the top of their article. Processing the single article gives the desired output. So far so good. When I receive the articles, I want to use the project/product/component structure to allow me to produce an entire issue of the journal in one go. (I would simply comment out the \input line and add \startproject \startcomponent etc lines as necessary from each received article.) Problem: I've created a custom chapter heading, but the font size changes depending on whether I'm processing the \input version of the article or the \component version and I don't know why. Obviously, I would like the heading to be the same in each case so that authors see what I see and vice versa. I've attached a small zip file with a directory structure containing a minimal example. There are two directories: "input_version" and "project" version and the article.pdf files in each show the difference in the heading. I'm using TeX Live 2020 on a Mac. The console reports: ConTeXt ver: 2020.03.10 14:44 MKIV beta fmt: 2020.4.18 int: english/english -- Bruce Horrocks Hampshire, UK

2 3

unwanted vertical spaces after sectionhead in column layout
by Damien Thiriet 02 May '20

02 May '20

Hello list, Looks like lmtx adds extra vertical space after heads. Compare those two MWE: \setuppapersize [S4] \setuphead [subject] [after={}] \starttext \startsubject[title={blabla}] \input knuth \stopsubject \stoptext \setuppapersize [S4] \setuphead [subject] [after={}] \starttext \startcolumns [n=3] \startsubject[title={blabla}] \input knuth \stopsubject \stopcolumns \stoptext Greetings, Damien Thiriet (missing BachoTeX)

1 0

supp-ran.lua makes code unable to work in ConTeXt
by Jairo A. del Rio 02 May '20

02 May '20

I've adapted the following code to make mazes in LuaLaTeX and ConTeXt: https://www.rosettacode.org/wiki/Maze_generation#Lua I defined a modified version to make content visible to TeX and I saved in a file named maze.lua: function make_maze_tex(w, h, m) w = w or 16 h = h or 8 local map = initialize_grid(w*2+1, h*2+1) function walk(x, y) map[y][x] = false local d = { 1, 2, 3, 4 } shuffle(d) for i, dirnum in ipairs(d) do local xx = x + dirs[dirnum].x local yy = y + dirs[dirnum].y if map[yy] and map[yy][xx] then map[avg(y, yy)][avg(x, xx)] = false walk(xx, yy) end end end walk(math.random(1, w)*2, math.random(1, h)*2) tex.print([[\bgroup]]) tex.print([[\baselineskip ]]..m) local s = {} for i = 1, h*2+1 do --table.insert(s, [[\hbox{]]) tex.print([[\hbox{]]) for j = 1, w*2+1 do -- table.insert(s, [[\hbox{]]) if (j == 1 and i == 2) or (j == 2*w + 1 and i == 2*h) then tex.print([[\hskip ]]..m) elseif map[i][j] then --table.insert(s, [[\vrule width ]]..m..[[ height ]]..m) tex.print([[\vrule width ]]..m..[[ height ]]..m) else --table.insert(s, [[\hskip ]]..m) tex.print([[\hskip ]]..m) end -- table.insert(s, [[}]].."\n") end --table.insert(s, [[}]]) tex.print([[}]]) end --tex.print(table.concat(s)) tex.print([[\egroup]]) end And I executed the folowing in LuaLaTeX and ConTeXt: %\documentclass{article} %\usepackage{luacode} %\begin{document} \starttext %\begin{luacode*} \startluacode mz = dofile("maze.lua") local count = 0 for i=10,109 do count = count + 1 tex.print([[\subject{Laberinto ]]..count..[[}]]) mz.make_maze_tex(i, i, [[\dimexpr\textwidth/]]..(2*i+1)..[[\relax]]) tex.print([[\pagebreak]]) end %\end{luacode*} \stopluacode %\end{document} \stoptext Whereas it works very fast in LuaLaTeX it crashes on ConTeXt and outputs the following: token call, execute: ...ext/tex/texmf-context/tex/context/base/mkiv/supp-ran.lua:30: C stack overflow Why does it happen? I guess it has something to do with math.randomseed, but I don't know how to avoid this error message.

3 5

.so libraries not working with LMTX
by Jairo A. del Rio 01 May '20

01 May '20

I've tried using some C libraries for Lua in LuaTeX: http://webserver2.tecgraf.puc-rio.br/~lhf/ftp/lua/ They work (both LuaLaTeX and ConTeXt), but when LMTX is used, the following message appears (an example with MAPM): token call, execute: ...xt/tex/texmf-context/tex/context/base/mkiv/l-package.lua:325: error loading module 'mapm' from file './mapm.so': ./mapm.so: undefined symbol: lua_settop I've compiled both with Lua 5.3.5 and Lua 5.4.0 (rc1 and rc2) and both work successfully for test.lua (command line). However, they just don't work with LMTX. Is this a bug or feature of LMTX? Thank you in advance.

2 1

[rotate question]
by Floris van Manen 01 May '20

01 May '20

I try to introduce a per character rotation using lua. But a negative rotation angle seems to introduce a vertical offset to the base line. It might be intended, but how to get it gone? Any hints? .Floris \def\streepA{% \rotate[rotation=\ctxlua{context(math.random(1,15))}]{\|}% } \def\streepB{% \rotate[rotation=\ctxlua{context(math.random(-15,-1))}]{\|}% } \def\stapA#1{\dorecurse{#1}{\streepA}} \def\stapB#1{\dorecurse{#1}{\streepB}} \starttext \startTEXpage[offset=20mm, width=297mm] \startalignment[width]~ \dorecurse{50}{\stapA{10}\stapB{10}} \stopalignment \stopTEXpage \stoptext

1 0

How do I get an empty line in a \framed[align=flushleft]{} item?
by Gerben Wierda 01 May '20

01 May '20

In normal TeX, when I type Aap\\\\Aap I get something like Aap Aap But inside a \framed[align=]{} the empty line disappears. How do I get it back? Minimal example: \starttext Testing\\\\Testing \page \framed[align=flushleft]{Testing\\\\Testing} \stoptext

4 11

module article-basic interferes with \definebodyfont?
by Gerben Wierda 01 May '20

01 May '20

The following code: \enabletrackers[context.trace] %\usemodule[article-basic] \starttypescript [sans] [optima] \setups[font:fallback:sans] \definefontsynonym [Sans] [file:Optima.ttc(Optima Regular)] [features=default] \definefontsynonym [SansBold] [file:Optima.ttc(Optima Bold)] [features=default] \definefontsynonym [SansItalic] [file:Optima.ttc(Optima Italic)] [features=default] \definefontsynonym [SansBoldItalic] [file:Optima.ttc(Optima Bold Italic)] [features=default] \stoptypescript \definetypeface [optima] [ss] [sans] [optima] [default] \setupbodyfont [optima] \starttext \startMPpage[instance=doublefun] picture pic; pic := textext("\definebodyfont[14.9pt][rm][default=Regular at 14.9pt]\switchtobodyfont[14.9pt]\setupinterlinespace[16.9pt]\framed[align=center,frame=off,offset=none,width=335.350bp]{\colored[r=0.000, g=0.000, b=0.000]{\rm (Artifact)\\}}"); draw pic scaled 1.13; \stopMPpage \stoptext Produces nice Optima at 14.9pt without \usemodule[article-basic] (as above), but with \usemodule[article-basic] included, the output becomes some serif (modern?) font, but only if I use nonstandard font sizes. Took me some time to hunt this one down. I actually don’t know what article-basic does for me (I started out with an example given to me by Hans) and I don’t need it now, but I might need it later in combination with my own stuff G

3 10

Trouble setting PDF boxes
by Jack Steyn 01 May '20

01 May '20

Hi, I am having trouble setting the PDF boxes to my desired dimensions. Suppose I have \setuppapersize[*a*][*b*]. I want CropBox = MediaBox = *b*. So far, so good: I can just use cropoffset=0mm in \setuplayout. But I want TrimBox = *a*. However, as far as I can see, I can't achieve this using trimoffset in \setuplayout unless (width of *b*) – (width of *a*) = (height of *b*) – (height of *a*), which does not hold in my case. So it looks like I need to find another way to set the TrimBox (and the BleedBox, which I want to be 3mm wider and taller than the TrimBox). Does anyone know how to do this? Best, Jack

3 6

Fwd: Unicode normalization and Hebrew in ConTeXt
by Joey McCollum 30 Apr '20

30 Apr '20

Thank you for the prompt and thorough response! If the reorderings have to be done for each pair of characters in different combining classes that are not in the expected typographical order, then there will be a lot (probably hundreds) of substitution rules. I am not very familiar with coding in Lua, but if there is a way to add substitution features for specific classes of points, then that would require a lot fewer cases. Unicode's canonical ordering of Hebrew marks is based on their combining classes, with characters in higher combining classes being sorted after those with lower combining classes in canonical order. The typographically recommended ordering of certain characters is found in Table 1 (p. 12) of https://www.sbl-site.org/Fonts/SBLHebrewUserManual1.5x.pdf. The following list of character classes, with information about their Unicode combining classes (which I retrieved from the Lua script https://raw.githubusercontent.com/michal-h21/uninormalize/master/char-def-w…) is indexed after the character classes described in that table: 1. The consonants (Unicode points 05D0-05EA) have no combining class and are never reordered; this is typographically correct. 2. Shin dot and sin dot (05C1-05C2) should be next, but Unicode places them in combining classes 24 and 25, after the characters in recommended classes 3-5 and many of the characters in recommended class 6. 3. Dagesh / mapiq (05BC) should be next, but Unicode assigns it a combining class of 21. This means that it will be incorrectly ordered before characters in recommended class 2 and after characters in recommended classes 4-6 after Unicode normalization. 4. Rafe (05BF) should be next, but Unicode assigns it a combining class of 23. Thus, it will be correctly placed after characters in recommended class 3, but incorrectly placed before characters in recommended class 2 after Unicode normalization. 5. The holam and holam haser vowel points (05B9-05BA) should be next, but Unicode places them in combining class 19. This means that it will be placed incorrectly before characters in recommended classes 2-4 and after all characters in recommended class 6 except 05BB after Unicode normalization. 6. The characters in 0591, 0596, 059B, 05A2-05A7, 05AA, 05B0-05B8, 05BB, 05BD, 05C5, 05C7 should be treated as being in the same class, but Unicode places them in combining classes 10-18, 20, 22, and 220. 7. The prepositive marks yetiv and dehi (059A, 05AD) should be next; Unicode places them in combining class 222, so they should correctly come after all characters in recommended classes 1-6. 8. The characters 0307, 0593-0595, 0597-0598, 059C-05A1, 05A8, 05AB-05AC, 05AF, 05C4 should be treated as being in the same class; Unicode places them in combining class 230, so they should correctly come after all characters in recommended classes 1-7. 9. The postpositive marks segolta, pashta, telisha qetana, and zinor (0592, 0599, 05A9, 05AE) should be next; Unicode places them in combining class 230, so they will need to be reordered after the characters in recommended class 8. This a lot of information, and I've probably not presented it as clearly as I could, so if there is any confusion, please let me know, and I can try to explain better. If there is any other information you need, please let me know. Thanks again! On Tue, Apr 28, 2020 at 9:17 AM Hans Hagen <j.hagen(a)xs4all.nl> wrote: > On 4/28/2020 1:59 PM, Joey McCollum wrote: > > \definefontfeature[f:pointedhebrew][default][ > > ccmp=yes, > > mark=yes, > > script=hebr > > ] > > \definefontfamily[hebrew] [rm] [SBL Hebrew] [features=f:pointedhebrew] > > %Set the body font: > > \setupbodyfont[hebrew] > > %Set up right-to-left alignment: > > \setupalign[r2l] > > \starttext > > %Characters after normalization, in Unicode canonical order (bet + > > segol + dagesh + final nun): > > בֶּן > > > > %A word with characters in typographically recommended order (bet + > > dagesh + segol + final nun): > > בֶּן > > \stoptext > > \startluacode > fonts.handlers.otf.addfeature { > name = "normalizehebrew", > type = "chainsubstitution", > prepend = 1, > lookups = { > { > type = "multiple", > data = { > [0x5B6] = { 0x5BC, 0x5B6 }, > }, > }, > }, > data = { > rules = { > { > current = { { 0x5B6 }, { 0x5BC } }, > lookups = { 1, 0 }, > }, > }, > }, > } > \stopluacode > > \definefontfeature > [f:pointedhebrew] > [hebrew] > [normalizehebrew=yes] > > \definefontfamily[hebrew] [rm] [SBL Hebrew] [features=f:pointedhebrew] > > \setupbodyfont[hebrew] > > \setupalign[r2l] > > \starttext > בֶּן \quad בֶּן \par > \stoptext > > How many such reorderings are there? (I saw some document about that > font and it sounds like a bit messy wrt all these input variants.) > > (there are several mechanisms in context to deal with such issues, it's > all about getting specs from users i.e. tex is all about control so in > principle it should be doable) > > Hans > > ----------------------------------------------------------------- > Hans Hagen | PRAGMA ADE > Ridderstraat 27 | 8061 GH Hasselt | The Netherlands > tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl > ----------------------------------------------------------------- >

3 4

Problem including svg files with Inkscape 1.0~rc1-4
by Romain Diss 30 Apr '20

30 Apr '20

Hi, The last release candidat of Inkscape (1.0~rc1-4 on my Debian sid) doesn't provide the `--export-pdf=` option anymore. So context can not convert svg files into the corresponding `m_k_i_v_*` pdf. It seems that the `--export-filename=` option does the job. Thank in advance. -- Romain Diss

3 7

Project setup query
by Alan Bowen 30 Apr '20

30 Apr '20

This is a minor issue—to which I expect the answer will be simple, something I should know by now but do not. I am just trying to see if I can streamline a working directory. In Directory01, I have a number of prd_NameXX.tex files as well as a Directory02 which contains .tex files that are to be called on by each one of the prd_Name.tex files. Is there a way to identify the TEX root for each of the common files (in Directory02) so that the file will be processed when I process any one of the prd files in Directory01? I have tried % !TEX root=../prd_\mystring.tex with, e.g., \def\mystring{Name01} in the prd_Name01.tex file, but that does not seem to work—the various .tex files re not found. What puzzles me is that the environment files in Directory02 are found. (That they are identified in a prj file in Directory01 does not seem to be the reason why.) There is no problem if I move the contents of Directory02 into Directory01. Alan

2 1

Getting page width and height in Lua
by Jack Steyn 30 Apr '20

30 Apr '20

If I want to get the paper width and height to use in some Lua code, I can use: local paperwidth, paperheight = backends.pdf.codeinjections.getpagedimensions() But what if I want to get the page width and height? That is, the width and height of the first argument in the two-argument version of \setuppapersize. Does anyone know how I can obtain these using Lua? Many thanks, Jack

2 1

Is this a MetaFun bug or intended behaviour?
by Gerben Wierda 30 Apr '20

30 Apr '20

I wanted to use the macro simplified to remove duplicate points from a path, but it removes more than that: metapost log > (127,-107)..controls (117,-107) and (107,-107) metapost log > ..(97,-107)..controls (97,-130.33333333333334) and (97,-153.66666666666666) metapost log > ..(97,-177)..controls (117,-177) and (137,-177) metapost log > ..(157,-177)..controls (157,-170.33333333333334) and (157,-163.66666666666666) metapost log > ..(157,-157) metapost log > metapost log > >> Path at line 0: metapost log > (97,-177)..controls (117,-177) and (137,-177) metapost log > ..(157,-177)..controls (157,-170.33333333333334) and (157,-163.66666666666666) metapost log > ..(157,-157) First is path, second is simplified path. Is simplified maybe only supposed to work with cycles? G

1 0

image across 2 page spread
by jbf 30 Apr '20

30 Apr '20

Hi list, With 99% of work complete on a book, including single page images, I now find myself confronted with a final problem: how to run one image across facing pages or in other words, one image (plus its caption) across a two-page spread, such that there is no gap. I have tried a number of fairly crass attempts (obviously too simple) to see if I could get somewhere near what I want, e.g. \externalfigure[plate12.jpg][width=\paperwidth, height=.7\paperheight, frame=none] {\tfx \sc Plates 12, 13. \tfx Twenty trucks from the Netherlands setting off} \externalfigure[plate13.jpg][width=\paperwidth, height=.7\paperheight, frame=none] {\tfx for their first mission amongst the German diaspora.} My thinking here was that \paperwidth might help extend the image to the inner edge on the left-hand page, but it doesn't work that way for the right-hand page, since there it extends to the outer edge, not the inner edge! The .7\paperheight was to provide room for the caption. But all in all, this is no solution! If it is any help, the setup dimensions for the book are US Digest: \definepapersize [ACN][width=5.5in,height=8.5in] % w140mm x h216mm I then looked up how one might do it in LaTeX, and found the following link: https://tex.stackexchange.com/questions/23860/how-to-include-a-picture-over… How much of that would be transferable to ConTeXt? (I am thinking particularly of the |\newcommand*{\twopagepicture}[4]| bit. There are explanations for how to do this in InDesign, and since it is something someone might often want to do (e.g. in magazines), I also thought it might be easier to find reference to it on Contextgarden, yet haven't found anything there. But I am sure ConTeXt has a way to do this. Could someone point me in the right direction with this please? Julian ||

4 3

further to the single image across two page spread
by jbf 30 Apr '20

30 Apr '20

After sending my previous email, I realised that my own attempt could be quite misleading, since there I was using two separate images across facing pages. I was simply trying to get the two images to 'marry' across the divide! But that is not my problem, since what I need to do is to get the one image (a suitable landscape image I might add) to run seamlessly across a two-page spread (which is what the LaTeX example I gave does). Sorry for any confusion, Julian

1 0

two additional pagenumber series
by Pablo Rodriguez 29 Apr '20

29 Apr '20

Dear list, for one of the documents I share with others, I need to add five pagenumber series. I’m already using realpage, userpage and subpage. I have just tried to use \definecounter, but it doesn’t work. \setuppapersize[A9] \definecounter[ncounter] [way=bychapter] \starttext \rawcountervalue[ncounter]\page \incrementcounter[ncounter][1] \page \lastcountervalue[ncounter] \chapter{} \lastcountervalue[ncounter] \stoptext I don’t know how to link any page increment to the defined counter. Although method is page, this seems to be related to a different issue. My question is: how could I get new pagenumber series using \definecounter? Many thanks for your help, Pablo -- http://www.ousia.tk

3 3

Right-to-left pagecolumns and markings in ConTeXt
by Joey McCollum 29 Apr '20

29 Apr '20

I am trying to typeset a two-column text in a right-to-left language using ConTeXt. Because I want footnotes in this text to be set ragged-bottom, I am using pagecolumns instead of standard columns. I also want to track the first and last textual division markers on each page using markings. Combining all of these ingredients seems to create a problem in ConTeXt: when the pagecolumns are set in right-to-left order, the top and bottom marks fetched are always the top and bottom marks in the left column, while the true top mark should be the top mark of the right column. I've observed this behavior using text in an actual right-to-left language, but the following minimal (non-)working example with an English sample text demonstrates the same behavior: ``` %Create a new markset to use: \definemarking[TestMark] %Setup header to reflect top and bottom marks: \setupheadertexts[top: {\fetchmark[TestMark][top]}][bottom: {\fetchmark[TestMark][bottom]}][top: {\fetchmark[TestMark][top]}][bottom: {\fetchmark[TestMark][bottom]}] %even left, even right, odd left, odd right %Setup the columns layout: \definepagecolumns [example] [ n=2, %number of columns direction=reverse, %does not work if ending comma is removed! ] \starttext \startpagecolumns[example] \marking[TestMark]{1}(1) \input knuth\par \marking[TestMark]{2}(2) \input knuth\par \marking[TestMark]{3}(3) \input knuth\par \marking[TestMark]{4}(4) \input knuth\par \marking[TestMark]{5}(5) \input knuth\par \marking[TestMark]{6}(6) \input knuth\par \marking[TestMark]{7}(7) \input knuth\par \marking[TestMark]{8}(8) \input knuth\par \stoppagecolumns \stoptext ``` I typeset this using ConTeXt version 2020.03.10, as released with TeXLive 2020. As my comment in the MWE points out, there also seems to be a bug in the key-value parsing of \definepagecolumns that causes it not to parse the direction=reverse input unless it is followed by a comma. Is there some way I can improve my syntax to avoid this issue, or is it just a bug that needs to be fixed? I've tried fetching other marks (e.g., first and last), but the only marks that ConTeXt seems to find are the ones for the left column. Thank you, Joey

2 4

Typesetting Markdown - Part 8
by Thangalin 28 Apr '20

28 Apr '20

Hi folks! Second last part in the series. The project, product, component, and environment relations were a bit finicky. Those willing to point out improvements that can be made---Hans, Taco, Wolfgang, Aditya, and others---would be very much appreciated. Specifically, it seems that some project environment settings can be overruled inside products, but other project settings cannot. It's not really clear to me whether this is due to dependency order or that definitions cannot be redefined across environments. Thoughts? https://dave.autonoma.ca/blog/2020/04/28/typesetting-markdown-part-8/ Stay safe!

5 13

\setupinteraction [ ...] do not work
by Fabrice Couvreur 28 Apr '20

28 Apr '20

Hi, It seemed to me that it was necessary to proceed in this way to create a link in a pdf file; it does not work. Thank you. Fabrice \setupinteraction[state=start,color=darkred] \starttext \goto{vecteur directeur}[https://www.youtube.com/watch?v=6VdSz-0QT4Y] \stoptext

2 1

LMTX rollback?
by Rik Kabel 27 Apr '20

27 Apr '20

My update script reports: 2020-04-27T12:40:53 ConTeXt updated from 2020.04.19T19:43 to 2020.04.26T19:59 2020-04-27T12:40:53 LuaMetaTeX updated from 2.05.02 to 2.05.01 2020-04-27T12:40:53 LuaMetaTeX functionality updated from 20200413 to 20200402 Is this an intentional rollback or a website issue? -- Rik

1 0

Using \startuseMPgraphic inside a textext() in METAPOST?
by Gerben Wierda 27 Apr '20

27 Apr '20

I am in METAPOST which is inside TeX and I’d like (in METAPOST, not in TeX) to let a string follow a path. Adapting from the MetaFun manual around page 250, I tried this: \starttext \startMPpage[instance=doublefun] pic p; p := textext("\startuseMPgraphic[instance=doublefun]{followtokens}path RotPath ; RotPath := fullcircle ;\stopuseMPgraphic\followtokens{I am creating a line of text here}"); draw pic; \stopMPpage \stoptext But that does not work. Is there a way I can from within my METAPOST code get string (TeX code) to follow a path I have? In my case, I cannot escape outside the \startMPpage- -\stopMPpage environment, as the actual path is constructed there and the text following the path should be on that page. G

2 1

simple way to change value of 'x' in \tfx?
by jbf 27 Apr '20

27 Apr '20

I have the following setup currently, involving: \definefontfamily[mainface][rm][texgyrepagella][tf=file:texgyrepagella-regular.otf] \setupbodyfont[mainface,11pt] \setupbodyfontenvironment[default] [em=italic] \setupdelimitedtext[blockquote][style=\tfx, before={\blank\setupinterlinespace[line=2.4ex]},after={\blank}] My publisher thinks the default scaling of 'x' (0.8) is too small for the blockquoted text, and asked if I could simply indicate 10pt for 'x'. I tried by using the line: \definebodyfontenvironment[default] [x=10pt] but that did nothing to change things. I tried a few other possibilities as well, e.g. just adding the x=10pt after the em=italic declaration, but that didn't work either. I'm sure there is a simple way to achieve what I want. Any thoughts? Julian

2 1

\framed[align=] with a 'maxwidth' instead of a width? Or get the size of a \frame returned to lua without typesetting it in a document?
by Gerben Wierda 26 Apr '20

26 Apr '20

Setup: TeX file Contains ctxlua{} call lua function reads XML file and calls context() statements, it puts out a \startMPpage METAPOST statements Of which some are textext(\framed[align, so vbox, width defined by lua]{}, the whole TeX string for textext is created in lua and passed whole on to METAPOST as METAPOST is pretty limited on string manipulation compared to lua) \stopMPpage I am running into the following conundrum: If I do give it a width (say a maximum) it will also be that wide when it is mostly empty if there is little text, this interferes with optimal placing If I don’t give a width to the \framed command it may grow far too wide if there is a lot of text instead of wrapping around. The typeset text is rather unpredictable. It may be three very short single-word lines with \\ at the end but it may also be a large paragraph. So, I would like to find a way to let the \framed become a box as narrow as possible, but not growing wider than a pre-set width. This is way too difficult for my meagre skills. What I could do (but I think is clumsy) is pass two \framed commands to METAPOST, have both by typeset with textext() and if the one without a width becomes too wide, take the one with the width set. But I would like a neater option. E.g. call TeX (no need for METAPOST in between) from lua to typeset the \framed without actually typesetting it to the document and getting the dimensions back to lua so I can decide there what to do. Or a \specialframed command where I don’t give it a ‘width', but a ‘maxwidth’ Is one of these doable? If not, I’ll have to implement the ‘clumsy’ route. Preferably (the what is now thought of as ideal solution) I would be able in lua to give a piece of TeX code to TeX and ask it to produce a box and give me the dimensions of that box. That alone would give me an option, e.g. - trial typeset - if box surface (w*h) is more than what is available, shrink font size and lineheight so the total will be within set limits, then typeset it again with the smaller font and max width available - else, if trial box width is more than the width available, typeset again with fixed width - else use the way the trial box was typeset But I’m still puzzling. G PS. Why is the bbox of a textext(\framed[]{}) slightly larger than the frame?

1 0

register entries in footnotes
by Thomas A. Schmitz 26 Apr '20

26 Apr '20

A similar question has been asked three years ago, and Rik Kabel posted a partial solution, adapted here: \defineprocessor [Footnote] [right={ n}] \define[1] \fnindex{\index[Footnote->]{#1}} \starttext This is a sentence with a term in the index: cat\index{cat}. This sentence also has an indexed term, dog\index{dog}, as well as a footnote.\footnote{The footnote also contains an indexed term, mouse.\fnindex{mouse}} \page \placeregister [index] \stoptext And about a year ago, Hans made a different suggestion to my own question; however, I didn't realize then that it was not what I was looking for: \starttext Test1: \index{cat}cat. \footnote{Test2: \index{mouse}mouse.} \footnote[note:cat]{Test3: \index[cat]{cat in \in{note}[note:cat]}cat.} \page \placeregister [index] \stoptext This creates two index entries for cat, which is not the intended result. My questions are: 1. I would like to have the footnote number appear in the index, so it says something like "cat 1 n. 1." Is that possible? 2. Is it necessary to define an extra command for index entries in footnotes? Is context clever enough to know that it's processing a footnote, so one could write a condition such as (pseudocode): \define [1] \myindex {\infinfootnoteelse {\index[Footnote]->{#1}} {\index{#1}}} Thanks a lot, have a good Sunday! Thomas

2 1

Re: [NTG-context] Basic font question (Optima, but no bold, no italics). Standalone ConTeXt does not work. TeX Live 2019 works
by Benjamin Buchmuller 26 Apr '20

26 Apr '20

Hi Hraban, Thanks for the hint (and the proper fontfamily setup), I have forced reload ten times now from various accounts; the issue persists unfortunately. This might confirm Taco‘s notion that there is some bug lmtx. I’m running macOS Catalina too, but as it worked with the standalone of Dec/Jan three days ago, I suspect it is not because of a new feature in the OS, but rather an old feature in mtxrun or elsewhere having disappeared. > On 24. Apr 2020, at 11:35, Henning Hraban Ramm <texml(a)fiee.net> wrote: > > > >> Am 24.04.2020 um 11:13 schrieb Benjamin Buchmuller <benjamin.buchmuller(a)gmail.com>: >> >> Although this specific issue might have been solved meanwhile by the helpful suggestions of Wolfang, Thomas and others, I would like to point out that I have recently also encountered an odd behaviour of the mtxrun fontloader in the standalone, in which not all typefaces are available/properly identified. >> >> (I’m sorry to hijack this thread if this is unrelated.) >> >> Basically, when I load “Helvetica Neue”, I get instead of “regular/normal” always “light/italic”. >> >> I have switched to heros for the meantime, but potentially there is some bug behind this. (My documents with the version from Dec/Jan worked fine.) >> >> I recite my example from Wed: >> >> ConTeXt ver: 2020.01.30 14:13 MKIV beta fmt: 2020.4.22 (LuaTeX 1.11.1) >> >> and I’m running now into troubles with system font indexing: >> >> mtxrun --script fonts --reload >> >> locates fonts in macOS directories appropriately (*.afm fonts placed in .../tex/texmf-fonts are not found, but at the moment I don’t care too much), however it resolves only to a single font variant for *.ttc instead of all variants: >> >> mtxrun --script fonts --list --all --pattern=helvetica >> >> helvetica helvetica helveticalightoblique /System/Library/Fonts/Helvetica.ttc 6 >> helveticalightoblique helvetica helveticalightoblique /System/Library/Fonts/Helvetica.ttc 6 >> helveticaneuedeskinterfaceheavy helveticaneuedeskinterface helveticaneuedeskinterfaceheavy /System/Library/Fonts/HelveticaNeueDeskInterface.ttc 10 >> helveticaneuethinitalic helveticaneue helveticaneuethinitalic /System/Library/Fonts/HelveticaNeue.ttc 14 > > If the subfont is not listed, ConTeXt/mtxrun couldn’t find it and won’t find it regardless of your setup. > > Try > mtxrun --script fonts --reload --force > maybe even twice or thrice and check again. > (Unfortunately this is not reliable.) > > I get the full list: > > identifier familyname fontname filename subfont instances > > helvetica helvetica helvetica /System/Library/Fonts/Helvetica.ttc 1 > helveticaneueblack helveticaneue helveticaneuecondensedblack /System/Library/Fonts/HelveticaNeue.ttc 10 > helveticaneuedeskinterfaceextrabold helveticaneuedeskinterface helveticaneuedeskinterfaceheavy /System/Library/Fonts/HelveticaNeueDeskInterface.ttc 10 > helveticaneuedeskinterfaceextralight helveticaneuedeskinterface helveticaneuedeskinterfacethin /System/Library/Fonts/HelveticaNeueDeskInterface.ttc 8 > helveticaneuedeskinterfacemedium helveticaneuedeskinterface helveticaneuedeskinterfacemediump4 /System/Library/Fonts/HelveticaNeueDeskInterface.ttc 5 > helveticaneuedeskinterfacemediumitalic helveticaneuedeskinterface helveticaneuedeskinterfacemediumitalicp4 /System/Library/Fonts/HelveticaNeueDeskInterface.ttc 6 > helveticaneuedeskinterfacenormal helveticaneuedeskinterface helveticaneuedeskinterfaceregular /System/Library/Fonts/HelveticaNeueDeskInterface.ttc 1 > helveticaneueextralight helveticaneue helveticaneuethin /System/Library/Fonts/HelveticaNeue.ttc 13 > helveticaneuenormal helveticaneue helveticaneue /System/Library/Fonts/HelveticaNeue.ttc 1 > helveticaneueregular helveticaneue helveticaneue /System/Library/Fonts/HelveticaNeue.ttc 1 > helveticanormal helvetica helvetica /System/Library/Fonts/Helvetica.ttc 1 > helveticaregular helvetica helvetica /System/Library/Fonts/Helvetica.ttc 1 > > > >> As a consequence, when I run >> >> \definefontfamily[mainface][ss][Helvetica Neue] >> \setupbodyfont[mainface, 12pt, sans] >> >> I get the light oblique variant instead of the regular one. I have tried to fix this via a >> >> \definefontfamily[mainface][ss][Helvetica Neue][tf=style:normal] > > tf=helveticaregular > should work. > > > Best, Hraban > >

2 2

Using \doifelse to change the itemization symbol in specific cases
by Kevin Kenan 25 Apr '20

25 Apr '20

I’m trying to create a conditional that changes the symbol used for certain item numbers. Here’s my code that doesn’t work. \define[1]\StepsCommand{\doifelse{#1}{2}{k}{#1}\ignorespaces} \defineitemgroup[Steps] \setupitemgroup[Steps][each][n,packed] \setupitemgroup[Steps][each][left=\StepsCommand] \starttext \startSteps \item A \item B % the item number should be replaced with 'k' \item C \stopSteps \stoptext The second item “B” should have the letter ‘k’ instead of the number “2.” Is this possible? Thanks, -kk

2 4

extracting pages using luacode
by Floris van Manen 25 Apr '20

25 Apr '20

I'm trying to extract pages from an existing pdf using lua. But this approach to extract pages 11 and 30 does not work: \starttext \startluacode for i, blz in ipairs({11, 30}) do context.startTEXpage() context.externalfigure("my_pdf.pdf", page=blz) context.stopTEXpage() end \stopluacode \stoptext Where am I missing the point? .F

2 2

Setting vertical spacing of lines inside a \framed[align=]
by Gerben Wierda 25 Apr '20

25 Apr '20

I have been experimenting with \startpacked..\stoppacked but it doesn’t seem to work. What is the preferred way of getting lines in a normal paragraph (actually, we’re talking about a \framed with align, so a full paragraph in a TeX \vbox) (In addition, I try to find this kind of information first, in the manuals and in ConTeXtgarden, but I am failing. E.g. I look it up in the manual, do not really find it, then look it up in ConTeXt garden but it isn’t really documentend, then click ‘look in source’ and th elink doesn’t work. So, I have to bother people on the list for a basic question like this. I must be doing something wrong and looking in the wrong place) Gerben Wierda Chess and the Art of Enterprise Architecture <https://ea.rna.nl/the-book/> Mastering ArchiMate <https://ea.rna.nl/the-book-edition-iii/> Architecture for Real Enterprises <https://www.infoworld.com/blog/architecture-for-real-enterprises/> at InfoWorld On Slippery Ice <https://eapj.org/on-slippery-ice/> at EAPJ

3 8

PGFPlots does not work with LMTX
by Jairo A. del Rio 25 Apr '20

25 Apr '20

I'm testing LMTX with documents I've written for ConTeXt MKIV. I've copied the third party module folder from ConTeXt and some of them work like a charm (t-vim, TikZ, etc.). Nonetheless, I find PGFPlots just doesn't work. I've tried with the minimal example: \usemodule[pgfplots] \starttext Hola \stoptext and LMTX gives the following error message (omitting spaces): tex error > tex error on line 42 in file pgfplotsbinary.data.code.tex: ! Undefined control sequence l.42 \catcode`\ =11^^I\expandafter\xdef\csname pgfp@bin@ \the\counter^^I\endcsname{^^20}\endgroup\advance\counter by1 lua error: ? <empty file> The control sequence at the end of the top line of your error message was never \def'ed. You can just continue as I'll forget about whatever was undefined. Why does it happen and how to make the code work?

2 1

Re: [NTG-context] Negative width vrule ignored in LuaMETATeX
by Hans Hagen 24 Apr '20

24 Apr '20

On 4/24/2020 7:44 PM, Ao Shen wrote: > Thanks for your timely reply! > > Hans Hagen <j.hagen(a)xs4all.nl> 于2020年4月24日周五下午11:38写道： >> >> no, but i must admit that it's kind of a border case ... i'll fix it but >> also wonder if *no* visual rule showing up is intended (i would then >> also expect an engine to show a rule .. could be an interesting new >> (luametatex) option as it saves kerns in some cases) > > My use cases of negative vrule is a little tricky. I'm trying to comply with > W3C's [Requirements for Japanese Text Layout](https://www.w3.org/TR/jlreq/). > It states that > > In principle, closing brackets (cl-02), commas (cl-07) or full stops (cl-06) > at the line end have a half em space after them (see Fig. 3.20). This half em > space can be deleted for line adjustment. However, the possibilities are only > half em space or solid. Other spaces, such as a quarter em space should not be > used. > > The tricky part is that I also want the opening fullwidth bracket at the > beginning of the line to be solid, i.e., without half em sidebearing on the left > to make the left margin visually more aligned (this is one but not the only way > of line begining handling shown in jlreq). > > To achieve this, in the scripts handler I use the following injector between > 'full_width_close' and 'full_width_open': > > \hskip -0.5em \penalty 100 \hskip 0.5em minus 0.5em \vrule width > -0.5em height 0pt > ^^^(a) ^^^(b) > > If line is broken here, the only broken points are (a) before the glue or (b) at > the penalty point. With the vrule the sidebearing of the opening bracket at > beginning of next line is eliminated. > > In this particular case, a kern is not applicable because it won't survive the > line break. And here a vrule showing nothing is intended. How about something ... \startluacode local classes = fonts.protrusions.classes local vectors = fonts.protrusions.vectors classes.myown = { vector = 'myown', factor = 1, } vectors.myown = table.merged (vectors.quality, { [0x0028] = { 1, 0 }, -- ( [0x0029] = { 0, 1 }, -- ) }) \stopluacode \starttext \showframe \definefontfeature[whatever][default][protrusion=myown] \definedfont[Serif*whatever] \setupalign[hanging] \dorecurse{100}{(#1) } \stoptext of course you need to define the cjk fences etc. Hans ----------------------------------------------------------------- Hans Hagen | PRAGMA ADE Ridderstraat 27 | 8061 GH Hasselt | The Netherlands tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl -----------------------------------------------------------------

1 0

Negative width vrule ignored in LuaMETATeX
by SAO Ocean 24 Apr '20

24 Apr '20

Hi, As I'm beginning to use ConTeXt LMTX, I experimented with it a little and noticed some of my old documents different. After some examination I found the following example: \starttext a\vrule width -5pt height 0pt depth 0pt b \stoptext In LMTX, the result looks as if there is no `\vrule' between `a' and `b'. And if I run with `context --engine=luatex', the expected result is back. I have checked the luametatex manual but it doesn't seem to mention the difference. My luametatex version is mkiv lua stats > used engine: luametatex version: 2.0502, functionality level: 20200413, format id: 493, compiler: clang. Is the behaviour expected? Or shall I use other method to get non-discardable negative space? Ao Shen

3 2

Re: [NTG-context] Basic font question (Optima, but no bold, no italics). Standalone ConTeXt does not work. TeX Live 2019 works
by Benjamin Buchmuller 24 Apr '20

24 Apr '20

Although this specific issue might have been solved meanwhile by the helpful suggestions of Wolfang, Thomas and others, I would like to point out that I have recently also encountered an odd behaviour of the mtxrun fontloader in the standalone, in which not all typefaces are available/properly identified. (I’m sorry to hijack this thread if this is unrelated.) Basically, when I load “Helvetica Neue”, I get instead of “regular/normal” always “light/italic”. I have switched to heros for the meantime, but potentially there is some bug behind this. (My documents with the version from Dec/Jan worked fine.) I recite my example from Wed: ConTeXt ver: 2020.01.30 14:13 MKIV beta fmt: 2020.4.22 (LuaTeX 1.11.1) and I’m running now into troubles with system font indexing: mtxrun --script fonts --reload locates fonts in macOS directories appropriately (*.afm fonts placed in .../tex/texmf-fonts are not found, but at the moment I don’t care too much), however it resolves only to a single font variant for *.ttc instead of all variants: mtxrun --script fonts --list --all --pattern=helvetica helvetica helvetica helveticalightoblique /System/Library/Fonts/Helvetica.ttc 6 helveticalightoblique helvetica helveticalightoblique /System/Library/Fonts/Helvetica.ttc 6 helveticaneuedeskinterfaceheavy helveticaneuedeskinterface helveticaneuedeskinterfaceheavy /System/Library/Fonts/HelveticaNeueDeskInterface.ttc 10 helveticaneuethinitalic helveticaneue helveticaneuethinitalic /System/Library/Fonts/HelveticaNeue.ttc 14 As a consequence, when I run \definefontfamily[mainface][ss][Helvetica Neue] \setupbodyfont[mainface, 12pt, sans] I get the light oblique variant instead of the regular one. I have tried to fix this via a \definefontfamily[mainface][ss][Helvetica Neue][tf=style:normal] but apparently I understand too little about this setup altogether … Thanks already for any suggestions! > On 24 Apr 2020, at 08:53, ntg-context-request(a)ntg.nl wrote: > > Send ntg-context mailing list submissions to > ntg-context(a)ntg.nl > > To subscribe or unsubscribe via the World Wide Web, visit > https://mailman.ntg.nl/mailman/listinfo/ntg-context > or, via email, send a message with subject or body 'help' to > ntg-context-request(a)ntg.nl > > You can reach the person managing the list at > ntg-context-owner(a)ntg.nl > > When replying, please edit your Subject line so it is more specific > than "Re: Contents of ntg-context digest..." > Today's Topics: > > 1. Re: Basic font question (Optima, but no bold, no italics). > Standalone ConTeXt does not work. TeX Live 2019 works > (Wolfgang Schuster) > > From: Wolfgang Schuster <wolfgang.schuster.lists(a)gmail.com> > Subject: Re: [NTG-context] Basic font question (Optima, but no bold, no italics). Standalone ConTeXt does not work. TeX Live 2019 works > Date: 24 April 2020 at 08:53:52 CEST > To: mailing list for ConTeXt users <ntg-context(a)ntg.nl>, Gerben Wierda <gerben.wierda(a)rna.nl> > > > Gerben Wierda schrieb am 24.04.2020 um 08:48: >> With Arial: >> >> \definefontfamily[mainface][rm][Arial] >> \setupbodyfont[mainface,10pt] >> >> <image.png> >> >> with Optima: >> >> \definefontfamily[mainface][rm][Optima] >> \setupbodyfont[mainface,10pt] >> >> <image.png> >> It doesn’t matter if the font statements are before or after \starttext >> >> Then I thought, let’s test some other things. I logged in as another user, and used ConTeXt from TeX Live 2019: >> >> <image.png> >> It seems to be that on my system, the standalone installed ConTeXt does not work with Optima, but the TeX Live installed one does. > > Can you try this: > > \definefontfamily [mainface] [rm] [Optima] > [it=optimaitalic, > bf=optimabold, > bi=optimabolditalic] > > Wolfgang > > > > ___________________________________________________________________________________ > If your question is of interest to others as well, please add an entry to the Wiki! > > maillist : ntg-context(a)ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context > webpage : http://www.pragma-ade.nl / http://tex.aanhet.net > archive : https://foundry.supelec.fr/projects/contextrev/ > wiki : http://contextgarden.net > ___________________________________________________________________________________

4 4

Re: [NTG-context] Hyphentation/Linebreak after x characters
by Benjamin Buchmuller 24 Apr '20

24 Apr '20

Hi Rik, Thanks for the fast reply! Your example works indeed nicely. However, within this solution my problem has shifted now (fully) towards breaking after the same number of characters, which seems to work for your sample string, but not for the sequences that I need to place. What I would like to achieve is something like: 5’-GATTGCTTACTCCTGGTTGG TGGGGCTTACATTCTGTCGCCTC AAAACTACTAGAGCCGGCATATT CTAGAAGGGCCGCCTTCATGTGG etc. (There might be hyphens or not, this is not so much important to me.) But what I get is currently: 5'-GATTGCTTACTCCTG- GTTGGTGGGGCTTACATTCT- GTCGCCTCAAAACTACTA- GAGCCGGCATATTCTA- GAAGGGCCGCCTTCATGTGGC- etc. Which looks ragged with \tt. Certainly, this is because ConTeXt applies the default hyphenation pattern. But I guess, there might be no “no language” pattern or is there? Also, I agree, it’s a bit odd that nright/nleft seem to make no difference towards the result. This is the MWE based on your solution: \define[2]\mycommandc{ \startxrow \startxcell o#1 \stopxcell \startxcell \tt\WORD{5'-#2} \stopxcell \stopxrow } \definebreakpoint[mybreaks][][nright=100,nleft=100,type=1] \setbreakpoints[mybreaks] \starttext \setupxtable[width=5cm] \startxtable \mycommandc{C}{GATTGCTTACTCCTGGTTGGTGGGGCTTACATTCTGTCGCCTCAAAACTACTAGAGCCGGCATATTCTAGAAGGGCCGCCTTCATGTGGCCTAGGGCACCATCGCGTACGAGGGCAAAAAATGAGTTTACCGCTGCGAAGTCTCTACGTCACGGCCAACCACAGTCCTGCTCCCAACGAAATTTAGACGCTGTCGTGAAACCTGAATTCGAGGATAAGCCGCGTCATGAAGAGTCTACTG} \stopxtable \stoptext > On 23 Apr 2020, at 22:02, ntg-context-request(a)ntg.nl wrote: > > Send ntg-context mailing list submissions to > ntg-context(a)ntg.nl > > To subscribe or unsubscribe via the World Wide Web, visit > https://mailman.ntg.nl/mailman/listinfo/ntg-context > or, via email, send a message with subject or body 'help' to > ntg-context-request(a)ntg.nl > > You can reach the person managing the list at > ntg-context-owner(a)ntg.nl > > When replying, please edit your Subject line so it is more specific > than "Re: Contents of ntg-context digest..." > Today's Topics: > > 1. Re: Hyphentation/Linebreak after x characters inside \WORD? > (Rik Kabel) > > From: Rik Kabel <ConTeXt(a)rik.users.panix.com> > Subject: Re: [NTG-context] Hyphentation/Linebreak after x characters inside \WORD? > Date: 23 April 2020 at 21:46:59 CEST > To: ntg-context(a)ntg.nl, benjamin.buchmuller(a)gmail.com > > > > > On 4/23/2020 15:01, Benjamin Buchmuller wrote: >> Sorry, I have just realized that the problem might not be \WORD{} actually, so this one hyphenates: >> >> \define[2]\mycommand{ >> \startxrow >> \startxcell o#1 \stopxcell >> \startxcell \tt\WORD #2 \stopxcell >> \stopxrow >> } >> >> Whereas these ones don’t: >> >> >> \define[2]\mycommand{ >> \startxrow >> \startxcell o#1 \stopxcell >> \startxcell \tt\WORD #2-3' \stopxcell >> \stopxrow >> } >> >> \define[2]\mycommand{ >> \startxrow >> \startxcell o#1 \stopxcell >> \startxcell 5'-\tt\WORD #2 \stopxcell >> \stopxrow >> } >> >> Assuming that this has to do with the presence of “-“ which will be the preferred breakpoint. So, I guess the questions boils down to how to define the second argument of >> >> \definebreakpoint[mybreaks][][nright=12,nleft=12,type=1] >> >> in this case or how to “deactivate” the default \setbreakpoints[compound]? >> >> >> >>> On 23 Apr 2020, at 20:46, Benjamin Buchmuller <benjamin.buchmuller(a)gmail.com> >>> wrote: >>> >>> Hi again, >>> >>> I am reading a CSV file into ConTeXt which contains long DNA sequences (>> 40 characters) to place in xtables. So far, this works fine. However, I need to uppercase the entries and need to \tt them. When I do this inside \WORD however, they don’t hyphenate any more. >>> >>> I’m using: >>> >>> \defineseparatedlist >>> [mylist] >>> [ >>> separator={,}, quotechar={"}, >>> command=\mycommand >>> ] >>> >>> \define[2]\mycommand{ >>> \startxrow >>> \startxcell o#1 \stopxcell >>> \startxcell 5’-{\tt\WORD{#2}}-3' \stopxcell >>> \stopxrow >>> } >>> >>> Since I don’t have access to each entry, I cant place hyphenation marks directly. Is there a way to tell ConTeXt to hyphenate after say, 12 characters? >>> >>> Thanks for your help. >>> >>> >>> Benjamin >>> > The following works for me: > > \define[2]\mycommanda{ > \startxrow > \startxcell o#1 \stopxcell > \startxcell \tt\WORD #2 \stopxcell > \stopxrow > } > > \define[2]\mycommandb{ > \startxrow > \startxcell o#1 \stopxcell > \startxcell \tt\WORD #2-3' \stopxcell > \stopxrow > } > > \define[2]\mycommandc{ > \startxrow > \startxcell o#1 \stopxcell > \startxcell 5'-\tt\WORD #2 \stopxcell > \stopxrow > } > > \definebreakpoint[mybreaks][][nright=12,nleft=12,type=1] > \setbreakpoints[mybreaks] > > \starttext > > \setupxtable[width=5cm] > \startxtablex > \mycommanda{A}{lsfkgjfkgshgkhigewhgajkdkfkalhfdklahfkhaakfakfh} > \mycommandb{B}{lsfkgjfkgshgkhigewhgajkdkfkalhfdklahfkhaakfakfh} > \mycommandc{C}{lsfkgjfkgshgkhigewhgajkdkfkalhfdklahfkhaakfakfh} > \stopxtable > > \stoptext > > > Producing: > > <nijiabomaaejpjhk.png> > > Indeed, it produces the same when nleft and nright are both set to 1 or 12 or 100, but not when setbreakpoints is removed. > > If you are trying to do something else, please provide an MWE. > > > ___________________________________________________________________________________ > If your question is of interest to others as well, please add an entry to the Wiki! > > maillist : ntg-context(a)ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context > webpage : http://www.pragma-ade.nl / http://tex.aanhet.net > archive : https://foundry.supelec.fr/projects/contextrev/ > wiki : http://contextgarden.net > ___________________________________________________________________________________

3 4

Basic font question
by Gerben Wierda 24 Apr '20

24 Apr '20

On my Mac, I am trying: \definefontfamily[mainface][rm][Optima] \setupbodyfont[mainface,10pt] {\bf Bold} and {\it Italic} and {\rm Regular} text. What do I need to do to get actual bold and italics in my output? Thx, G

6 16

Hyphentation/Linebreak after x characters inside \WORD?
by Benjamin Buchmuller 23 Apr '20

23 Apr '20

Hi again, I am reading a CSV file into ConTeXt which contains long DNA sequences (>> 40 characters) to place in xtables. So far, this works fine. However, I need to uppercase the entries and need to \tt them. When I do this inside \WORD however, they don’t hyphenate any more. I’m using: \defineseparatedlist [mylist] [ separator={,}, quotechar={"}, command=\mycommand ] \define[2]\mycommand{ \startxrow \startxcell o#1 \stopxcell \startxcell 5’-{\tt\WORD{#2}}-3' \stopxcell \stopxrow } Since I don’t have access to each entry, I cant place hyphenation marks directly. Is there a way to tell ConTeXt to hyphenate after say, 12 characters? Thanks for your help. Benjamin

2 2

useexternaldocument with custom file type
by Jan U. Hasecke 23 Apr '20

23 Apr '20

Hi, can I link to a file with custom file type eg. OpenDocument with \useexternaldocument? This does not work. \useexternaldocument[test][test.ods][A test document] As the PDF viewer is opened first, it does not recognize the file type. juh

4 8

Is there a 'sized' command equivalent to \colored?
by Gerben Wierda 23 Apr '20

23 Apr '20

I can directly colour a text in rgb by doing \colored[r=0.8,b=0.6,c=0.4]{Text}. Suppose I want to hard code a piece of text as 12.8pt, is there a simple way to do that directly like with \colored for colour? G

1 1

problem using LMTX
by Charles Doherty 23 Apr '20

23 Apr '20

The print-out below is from two runs on a Newsletter that I produce. Taco kindly told me to add \loadmarkfile{page-mul} to my input file some months ago to solve a problem with footnotes. I use an engine in TeXShop and I get the result 1) below (which is what I want) in the first example. I am happy to keep using this version of ConTeXt. However, as a matter of interest, I installed LTMX in a separate folder and used a different TeXShop engine directed to that installation and when I do I get the bottom result 2). As you can see there is a lot of white space between the end of the text and the footnotes in that run. This happens with the articles in my newsletter that have footnotes. Can this be fixed? Very best wishes and thanks for past help. Charlie 1) mtx-context | run 1: luatex --fmt="/Users/charlesdoherty/OLDcontext-osx-64/tex/texmf-cache/luatex-cache/context/5fe67e0bfe781ce0dde776fb1556f32e/formats/luatex/cont-en" --jobname="Newsletter2019-20" --lua="/Users/charlesdoherty/OLDcontext-osx-64/tex/texmf-cache/luatex-cache/context/5fe67e0bfe781ce0dde776fb1556f32e/formats/luatex/cont-en.lui" --c:autopdf --c:currentrun=1 --c:fulljobname="./Newsletter2019-20.tex" --c:input="./Newsletter2019-20.tex" --c:kindofrun=1 --c:maxnofruns=9 --c:purgeall --c:texmfbinpath="/Users/charlesdoherty/OLDcontext-osx-64/tex/texmf-osx-64/bin" "cont-yes.mkiv" This is LuaTeX, Version 1.10.1 (TeX Live 2019) system commands enabled. 2) resolvers | formats | executing runner 'run luametatex format': /Users/charlesdoherty/context-osx-64/tex/texmf-osx-64/bin/luametatex --jobname="Newsletter2019-20" --fmt=/Users/charlesdoherty/context-osx-64/tex/texmf-cache/luatex-cache/context/5fe67e0bfe781ce0dde776fb1556f32e/formats/luametatex/cont-en.fmt --lua=/Users/charlesdoherty/context-osx-64/tex/texmf-cache/luatex-cache/context/5fe67e0bfe781ce0dde776fb1556f32e/formats/luametatex/cont-en.lui cont-yes.mkiv --c:autopdf --c:currentrun=1 --c:directives="system.showerror" --c:fulljobname="./Newsletter2019-20.tex" --c:input="./Newsletter2019-20.tex" --c:kindofrun=1 --c:maxnofruns=9 --c:purgeall --c:texmfbinpath="/Users/charlesdoherty/context-osx-64/tex/texmf-osx-64/bin" This is LuaMetaTeX, Version 2.05.01

1 0

Setting up macvim in mac os catalina to work with LMTX
by Jan-Erik Hägglöf 23 Apr '20

23 Apr '20

Hi ! I am curious about testing macvim and it seems doing fine in edit mode. But how do i set up the typesetting engine? As far as I understand, there is, the command :ConteXt with guidance from the wiki https://wiki.contextgarden.net/Vim <https://wiki.contextgarden.net/Vim> But I do not understand how to customize it to be directed to the path to my engine I’ve installed the LMTX in /Users/janneman/context-osx-64/ The installation works fine in TeXshop but still an error shows up in macvim and the message dissappears very quick so there is not much time to read the cause of error. I have created the subdirectory .vim/ftplugin/ and put the context.vim file there also the corresponding in .vim/compiler/context.vim which is copied from the program located in /usr/local/Cellar/macvim/8.2-163/MacVim.app/Contents/Resources/vim/runtime So, how do I get this up and running? Thanks in advance Regards /Janne

4 8

lmtx & lohit-devanagari fonts
by Saša Janiška 23 Apr '20

23 Apr '20

Hello! I'm working on a small presentation for an upcoming video meeting and started writing some points in Markdown. After using Pandoc to convert I noticed that *.pptx file does contain everything, but if I try with ConTexT, then Devanagi and some diacritics are missing. By inspecting *.pdf file produced by: Pandoc --> PPTX --> LibreOffice --> PDF I can see that Lohit-Devanagari font is used for Sanskrit and I have it installed on my Fedora (fc32) desktop machine. Here is the test file: \starttext ध्यायतो विषयान्पुंसः सङ्गस्तेषूपजायते । सङ्गात्सञ्जायते कामः कामात्क्रोधोऽभिजायते ॥ ६२ ॥ dhyāyato viṣayān puṁsaḥ saṅgas teṣūpajāyate saṅgāt sañjāyate kāmaḥ kāmāt krodho ’bhijāyate Translation: ``While contemplating the objects of the senses, a person develops attachment for them, and from such attachment lust develops, and from lust anger arises.'' \stoptext which I would like to quote - I am somewhat familiar with latin transliteration via diacritics, but completely ignorant in regard to Devanagari - but wonder what is required to make ConText (lmtx) typeset it? Here is the log file: $ context t.tex resolvers | formats | executing runner 'run luametatex format': /home/gour/opt/lmtx/tex/texmf-linux-64/bin/luametatex --jobname="t" --fmt=/home/gour/opt/lmtx/tex/texmf-cache/luatex-cache/context/5fe67e0bfe781ce0dde776fb1556f32e/formats/luametatex/cont-en.fmt --lua=/home/gour/opt/lmtx/tex/texmf-cache/luatex-cache/context/5fe67e0bfe781ce0dde776fb1556f32e/formats/luametatex/cont-en.lui cont-yes.mkiv --c:currentrun=1 --c:fulljobname="./t.tex" --c:input="./t.tex" --c:kindofrun=1 --c:maxnofruns=9 --c:texmfbinpath="/home/gour/opt/lmtx/tex/texmf-linux-64/bin" This is LuaMetaTeX, Version 2.05.02 open source > level 1, order 1, name 'cont-yes.mkiv' system > system > ConTeXt ver: 2020.04.19 19:43 MKIV beta fmt: 2020.4.21 int: english/english system > system > 'cont-new.mkiv' loaded open source > level 2, order 2, name '/home/gour/opt/lmtx/tex/texmf-context/tex/context/base/mkiv/cont-new.mkiv' system > beware: some patches loaded from cont-new.mkiv close source > level 2, order 2, name '/home/gour/opt/lmtx/tex/texmf-context/tex/context/base/mkiv/cont-new.mkiv' system > files > jobname 't', input './t', result 't' fonts > latin modern fonts are not preloaded languages > language 'en' is active open source > level 2, order 3, name './t.tex' fonts > preloading latin modern fonts (second stage) fonts > 'fallback modern-designsize rm 12pt' is loaded fonts > checking > char ध (U+00927) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char ् (U+0094D) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char य (U+0092F) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char ा (U+0093E) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char त (U+00924) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char ो (U+0094B) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char व (U+00935) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char ि (U+0093F) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char ष (U+00937) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char न (U+00928) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char प (U+0092A) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char ु (U+00941) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char ं (U+00902) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char स (U+00938) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char ः (U+00903) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char ङ (U+00919) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char ग (U+00917) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char े (U+00947) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char ू (U+00942) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char ज (U+0091C) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char । (U+00964) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char ञ (U+0091E) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char क (U+00915) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char म (U+0092E) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char र (U+00930) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char ऽ (U+0093D) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char भ (U+0092D) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char ॥ (U+00965) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char ६ (U+0096C) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char २ (U+00968) in font 'LMRoman12-Regular' with id 1: missing fonts > checking > char ṁ (U+01E41) in font 'LMRoman12-Regular' with id 1: missing backend > xmp > using file '/home/gour/opt/lmtx/tex/texmf-context/tex/context/base/mkiv/lpdf-pdx.xml' pages > flushing realpage 1, userpage 1, subpage 1 close source > level 2, order 3, name './t.tex' close source > level 1, order 3, name 'cont-yes.mkiv' mkiv lua stats > used config file: selfautoparent:/texmf/web2c/texmfcnf.lua mkiv lua stats > used cache path: /home/gour/opt/lmtx/tex/texmf-cache/luatex-cache/context/5fe67e0bfe781ce0dde776fb1556f32e mkiv lua stats > resource resolver: loadtime 0.004 seconds, 0 scans with scantime 0.000 seconds, 0 shared scans, 11 found files, scanned paths: <none> mkiv lua stats > stored bytecode data: 468 modules (0.244 sec), 93 tables (0.015 sec), 561 chunks (0.259 sec) mkiv lua stats > traced context: maxstack: 1416, freed: 0, unreachable: 1416 mkiv lua stats > cleaned up reserved nodes: 57 nodes, 9 lists of 442 mkiv lua stats > node memory usage: 6 attribute, 3 attribute_list, 1 glue, 51 glue_spec, 3 kern, 2 penalty, 2 temp, 2 whatsit mkiv lua stats > node list callback tasks: 8 unique task lists, 7 instances (re)created, 51 calls mkiv lua stats > used backend: lmtx version 0.10, pdf (backend for directly generating pdf output) mkiv lua stats > jobdata time: 0.001 seconds saving, 0.000 seconds loading mkiv lua stats > callbacks: internal: 122, file: 150, direct: 2, late: 0, function 1062, total: 1336 mkiv lua stats > randomizer: resumed with value 0.82539481794329 mkiv lua stats > result saved in file: t.pdf, compresslevel 3, objectcompresslevel 1 mkiv lua stats > loaded patterns: en::1, load time: 0.000 mkiv lua stats > loaded fonts: 2 files: latinmodern-math.otf, lmroman12-regular.otf mkiv lua stats > font engine: otf 3.111, afm 1.513, tfm 1.000, 7 instances, 3 shared in backend, 3 common vectors, 0 common hashes, load time 0.208 seconds mkiv lua stats > font embedding time: 0.014 seconds, 1 fonts mkiv lua stats > used platform: linux-64, type: unix, binary subtree: texmf-linux-64 mkiv lua stats > used engine: luametatex version: 2.0502, functionality level: 20200413, format id: 493, compiler: gcc mkiv lua stats > control sequences: 46009 of 65536 + 100000 mkiv lua stats > lua properties: engine: lua 5.4, used memory: 49 MB, ctx: 47 MB, max: 48 MB, hash chars: min(64,40), symbol mask: utf (τεχ) mkiv lua stats > runtime: 0.604 seconds, 1 processed pages, 1 shipped pages, 1.656 pages/second system | total runtime: 0.613 seconds of 0.667 seconds Strangely enough, in both Vim (used for writing this email) as well as in Emacs I can properly see both Devanagari and diacritics. :-) Sincerely, Gour -- From wherever the mind wanders due to its flickering and unsteady nature, one must certainly withdraw it and bring it back under the control of the self.

7 17

Text editors don't execute ConTeXt standalone
by Jairo A. del Rio 23 Apr '20

23 Apr '20

I've recently installed the ConTeXt standalone following the instructions listed below: https://www.contextgarden.net/Ubuntu However, commands as "context" and "mtxrun" only work when executed from terminal. When I specify these commands in a text editor (TeXstudio, Textadept), they just don't work, even with a full path specified. On the contrary, commands as "tex" or "latex" from TeX Live are visible to editors. How to fix that?

1 0

Best way to create a large number of documents from database
by Mojca Miklavec 23 Apr '20

23 Apr '20

Hi, I have been asked to create a few thousand PDF documents from a CSV "database" today (which I can easily transform into any other form, like XML or a lua table or TeX definitions or whatever). Generating a few thousand pages would be straightforward, but I'm sure there are some clever ways to handle this scenario as well, I'm just not aware of them :) One option is that I quickly draft a python script that creates a few thousand TeX documents and compiles them individually, but it might be easier if there was a way to just create a single template document and then run something like context --some-params --N=42 --output=document-0042.pdf template.tex or something along those lines. What's the best approach with the existing functionality? I would be more than grateful for any hints. Thank you very much, Mojca

7 13

Text size with lmt_text [ ]
by Fabrice Couvreur 23 Apr '20

23 Apr '20

Hi, As an extension of this discussion https://mail.google.com/mail/u/0/#inbox/QgrcJHsNlRfcqCPHBTrnSFbJKjGPwjbJnLL… (thanks to Wolfgang), I used the MetaFun interface with lmt_text [] ; I managed to pass the text and color parameters while I did not succeed using textext (). My problem is the size of the letters which is too small. Thank you. Fabrice \usecolors[xwi] \definecolor [prune] [r=1.29,g=.20,b=.83] \starttext \startMPcode vardef card(expr s, c) = image( draw fullsquare xyscaled (2cm,4cm); draw fullsquare xyscaled (1.8cm,3.8cm) withcolor \MPcolor{violet}; draw lmt_text[ text = s, color = c, style = "bold", ] ) enddef; draw card("A",red) rotatedaround((1cm,2cm),5); draw card("L",green) rotatedaround((1cm,2cm),-5) shifted(3.5cm,0); draw card("E",blue) rotatedaround((1cm,2cm),5) shifted(6cm,0); draw card("A","prune") rotatedaround((1cm,2cm),-5) shifted(9cm,0); \stopMPcode \stoptext

1 0

mtxrun fontloader in recent standalone
by Benjamin Buchmuller 22 Apr '20

22 Apr '20

I’ve just updated to the most recent standalone ConTeXt ver: 2020.01.30 14:13 MKIV beta fmt: 2020.4.22 (LuaTeX 1.11.1) and I’m running now into troubles with system font indexing: mtxrun --script fonts --reload locates fonts in macOS directories appropriately (*.afm fonts placed in .../tex/texmf-fonts are not found, but at the moment I don’t care too much), however it resolves only to a single font variant for *.ttc instead of all variants: mtxrun --script fonts --list --all --pattern=helvetica helvetica helvetica helveticalightoblique /System/Library/Fonts/Helvetica.ttc 6 helveticalightoblique helvetica helveticalightoblique /System/Library/Fonts/Helvetica.ttc 6 helveticaneuedeskinterfaceheavy helveticaneuedeskinterface helveticaneuedeskinterfaceheavy /System/Library/Fonts/HelveticaNeueDeskInterface.ttc 10 helveticaneuethinitalic helveticaneue helveticaneuethinitalic /System/Library/Fonts/HelveticaNeue.ttc 14 As a consequence, when I run \definefontfamily[mainface][ss][Helvetica Neue] \setupbodyfont[mainface, 12pt, sans] I get the light oblique variant instead of the regular one. I have tried to fix this via a \definefontfamily[mainface][ss][Helvetica Neue][tf=style:normal] but apparently I understand too little about this setup altogether … Thanks already for any suggestions! Benjamin

1 0

METAPOST: How do I get this 'max' cutafter to work?
by Gerben Wierda 22 Apr '20

22 Apr '20

I have these two paths, but cutting doesn’t work because the path to be cut takes the wrong intersection regardless of how I direct the path to be cut after (reverse or not). The path to cut after is a triangle with the base horizontal and the path to cut is a vertical line. The top of the triangle is the endpoint of the line and is selected as intersection by cutafter. This happens also if I reverse the triangle path, strangely enough. I have an alternative cutting algorithm, but that cuts as long as the length of cuttings is not 0, which is the case at the top too, so it won’t cut further. I need a reliable algorithm to make a ‘maximum cutafter’. What might be a good approach? G path arrowHead; arrowHead := (542,-77.000186920166016)..controls (545.33333333333337,-77.000186920166016) and (548.66666666666663,-77.000186920166016) ..(552,-77.000186920166016)..controls (550.33333333333337,-73.666853586832687) and (548.66666666666663,-70.333520253499344) ..(547,-67.000186920166016)..controls (545.33333333333337,-70.333520253499344) and (543.66666666666663,-73.666853586832687) ..cycle; path connection; connection := (420.00004959106445,-367)..controls (420.66670256708773,-367) and (421.333355543111,-367) ..(422.00000851913427,-367)..controls (425.33333917170194,-367) and (428.6666698242696,-367) ..(432.00000047683727,-367)..controls (442.00000015894574,-367) and (451.99999984105426,-367) ..(461.99999952316273,-367)..controls (464.76142345324098,-367) and (467,-364.76142382108867) ..(467,-361.99999997656772)..controls (467,-293.99999999218926) and (467,-226.00000000781074) ..(467,-158.00000002343228)..controls (467,-155.23857623850762) and (469.23857634039018,-153) ..(472.00000014901161,-153)..controls (495.33333338300389,-153) and (518.66666661699617,-153) ..(541.99999985098839,-153)..controls (544.76142368504975,-153) and (547,-150.76142367339932) ..(547,-147.99999983662815)..controls (547,-125.99999994554271) and (547,-104.00000005445727) ..(547,-82.000000163371837)..controls (547,-78.666668047283764) and (547,-75.333335931195691) ..(547,-72.000003815107618)..controls (547,-70.333398183460417) and (547,-68.666792551813217) ..(547,-67.000186920166016); show connection cutafter arrowHead; show connection cutafter (reverse arrowHead);

4 6

accessing prd file from component file
by Alan Bowen 22 Apr '20

22 Apr '20

When my component files were in the same directory as my component files, the line %! TeX root = prd_whatever allowed processing the component file from the component file. (I use TeXShop for this.) The project structure has been changed: the component files are in a subdirectory of the directory that has the prd file. Now, %! TeX root = prd_whatever no longer works. (E.g., it cannot find the environment files called in the prd file.) Is there a way to restore processing from the component file. My experiments are near to wearing out the “error” message/page. Alan

2 1

balance=yes eats up footnote in one-line column
by Joey McCollum 22 Apr '20

22 Apr '20

I noticed some unexpected behavior while putting together a minimal working example for a different issue. In a multi-column layout with column balancing turned on, if the first column contains a single line and that line contains a footnote, then the footnote will not be typeset. A minimal example demonstrating this follows: \starttext \startcolumns[n=2] A single line of text with balancing.\footnote{Footnote dropped in column balancing.} \stopcolumns \stoptext I typeset this using ConTeXt version 2020.03.10 (from the TeXLive 2020 distribution). Clearly, the situation I described is an exceptional one, but it could happen in some real cases (e.g., if the last page of a two-column text consists of a widowed line with a footnote), and in any event, this seems like unintended behavior, so I thought I should bring it to the mailing list's attention.

1 0

TOC- removing Contents 0
by jbf 22 Apr '20

22 Apr '20

A simple question, but I have not found an answer to it as yet: \completecontent does everything it is supposed to, including providing the title 'Contents' on the ToC page, but it also gives me as the first line in the ToC: Contents 0 In fact the ToC appears on page 1, but regardless of the page it is appearing on, is there a way I can prevent that line from being produced as part of the ToC? I assume it would be something I need to do in the following setup: \setupcombinedlist [content] [list={chapter,section,title,subject,subsection}] \setuplist[chapter][style=normal,alternative=b, before=] Grateful for any help with this, Julian

3 2

Re: [NTG-context] animation using \startuseMPgraphic
by Jeong Dal 21 Apr '20

21 Apr '20

Dear Hans, Of course, it runs so fast that it is meaningless to shorten the runtime. It is my old habit to check the algorithmic efficiency. It is just my interest. Thank you for your concern. Best regards, Dalyoung

2 2

conditional not working in \setuphead
by Pablo Rodriguez 20 Apr '20

20 Apr '20

Dear list, I have the following sample: \startbuffer[demo] <doc> <section id="section-i1"> <text>first</text> </section> <section id="section-i2"> <text>second</text> </section> </doc> \stopbuffer \startxmlsetups xml:initialize \xmlsetsetup{#1}{doc|section}{xml:*} \stopxmlsetups \xmlregistersetup{xml:initialize} \startxmlsetups xml:doc \xmlflush{#1} \stopxmlsetups \startxmlsetups xml:section \startsection[title={\xmlatt{#1}{id}}, beforesection={\doif{\xmlatt{#1}{id}}{\selectedtopic} {conditional}}] \xmlflush{#1} \doif{\xmlatt{#1}{id}}{\selectedtopic}{conditional} \stopsection \stopxmlsetups \def\selectedtopic{section-i1} \starttext \xmlprocessbuffer{main}{demo}{} \stoptext How can I make the conditional in the beforesection option work? Many thanks for your help, Pablo -- http://www.ousia.tk

2 2

Passing the parameters of a frame in an environment \startMPcode ... \stopMPcode
by Fabrice Couvreur 20 Apr '20

20 Apr '20

Hi, I try to reproduce the figure as faithfully as possible. I tried for the rounded corners to put the key corner = round, but it does not work. Thanks for your help. Fabrice \usecolors[xwi] \definecolor [prune] [r=1.29,g=.20,b=.83] \starttext \setupframed[frameletter][corner=round,align=normal] \startMPcode draw outlinetext.f ("\framed[frameletter]{A}") (withcolor darkred withpen pencircle scaled 1/10) rotated 5 xsized 2cm ; draw outlinetext.f ("\framed[frameletter]{L}") (withcolor green withpen pencircle scaled 1/10) rotated -5 xsized 2cm shifted (2cm,0); draw outlinetext.f ("\framed[frameletter]{E}") (withcolor \MPcolor{blueviolet} withpen pencircle scaled 1/10) rotated 5 xsized 2cm shifted (4.5cm,0); draw outlinetext.f ("\framed[frameletter]{A}") (withcolor \MPcolor{prune} withpen pencircle scaled 1/10) rotated -5 xsized 2cm shifted (6.5cm,0); \stopMPcode \stoptext

3 5

animation using \startuseMPgraphic
by Jeong Dal 20 Apr '20

20 Apr '20

Dear all, I am trying to make an animation using the animation module. But it draws 10 figures instead of creating animation. Is there anything I have to do more? Or, is there a better way to do this? Thank you for reading. Best regards, Dalyoung \startuseMPgraphic{inversionPoint}{n} vardef findPointD(expr C, Q, r) = numeric dist, ang; pair X, Y; dist := r**2/sqrt((xpart Q - xpart C)**2 + (ypart Q - ypart C)**2); ang := angle(Q - C); Y := C + dir(ang)*dist; Y enddef; numeric radius, now, move; pair A,B,C,P,Q; path p,q; radius := 2cm; C := origin; p := fullcircle scaled (2*radius); z[1] = point 6 of p; z[2] = point .8 of p; q := (1.5*z1 - .5*z2) -- (-.5z1 + 1.5*z2); %q := fullcircle scaled radius shifted (2cm, 1cm); draw p; draw q; %for i := 0 step 0.1 until 1: move := 0.1; now := move*\MPvar{n}; P := point now along q; Q := findPointD(C, P, radius); drawdot P; drawdot Q withcolor .625red; dotlabel.lft(textext("P"),P); dotlabel.rt(textext("Q"),Q) withcolor .625red; %endfor; \stopuseMPgraphic \usemodule[animation] \setupinteraction[state=start] \starttext %\startplacefigure[] \startanimation[menu=yes] \dorecurse{10}{ \useMPgraphic{inversionPoint}{n=\recurselevel} } \stopanimation %\stopplacefigure \stoptext

4 6

Cannot build plain format
by Henri Menke 19 Apr '20

19 Apr '20

Dear list, I'm trying to build the plain format but it fails with $ mtxrun --script plain --make [...] ! I can't find file `luatex-plain.tex'. but mtxrun can find the file. $ mtxrun --find-file "luatex-plain.tex" /opt/context/tex/texmf-context/tex/generic/context/luatex/luatex-plain.tex What am I doing wrong? Also another question: Does LMTX come with a plain format? Cheers, Henri

3 5

Use a counter in a reference?
by Kevin Kenan 19 Apr '20

19 Apr '20

I have a need to tag elements in a text in a way that they are sequentially numbered and can have references to refer to them. Something like: Here is some \tag[tagref]{\bf text} that is tagged. . . . Refer to tag \tagnumber[tagref] on page \at[tagref]. What is the best way to do this in ConTeXt? I’ve got a counter for tag number, but I’m not sure how to use \reference so that it uses my tag number. For instance: \definecounter[myTagCounter] . . . \reference[tagref]{\rawcountervalue[myTagCounter]} Doesn’t work. But perhaps I’m going about this incorrectly? Thanks in advance! -kk

2 2

Unexpected result when using PaperHeight and MetaFUun
by Keith McKay 19 Apr '20

19 Apr '20

Dear All I have problem understanding what is happening in the MWE below which is different from what I expected. I have created a shaded background using MetaFun with dimensions PaperWidth by PaperHeight which mimics \setuppapersize[A4,landscape} as expected. I then within \starttext \startMPpage... \stopMPpage \stoptext created a stripe of the shaded background, xscaled 2cm y scaled PaperHeight, but reversed, expecting it to cover the background top to bottom. However the top of the stripe seems to start at 10.5cm which is suspiciously half the height of A4, Landscape i.e. 21cm. I confirmed this by changing the shifted command to, shifted (19cm,10.5cm), and the stripe is positioned as expected. Am I missing something obvious in how MetaFun handles coordinates? I have asumed that in MetaFun, (0,0) is the bottom left corner. Or is it how I applied the shifted command? I'm using LuaMetaTex Version 2.05.01 ConTeXt ver: 2020.04.03 10:31 MKIV beta fmt: 2020.4.6 int: english/english Thanks and stay safe. Best Wishes Keith McKay %%%%%%%%%%% MWE %%%%%%%%%%%%%%% \setuppapersize[A4,landscape] \definelayer[mybg] [x=0mm, y=0mm, width=\paperwidth, height=\paperheight] % let the layer cover the full paper \startuniqueMPgraphic{blueShade} draw lmt_shade [ path = fullsquare xyscaled(PaperWidth,PaperHeight), direction = "up", alternative = "linear", colors = { "red", "blue" }, ]; \stopuniqueMPgraphic \setlayer[mybg]{\uniqueMPgraphic{blueShade}} \setupbackgrounds[page][background={mybg}] \starttext \startMPpage StartPage ; %Result Left draw lmt_shade [ path = fullsquare xscaled 2cm yscaled PaperHeight, direction = "down", alternative = "linear", colors = { "red", "blue" }, ]shifted (12cm,0cm); %Result Right draw lmt_shade [ path = fullsquare xscaled 2cm yscaled PaperHeight, direction = "down", alternative = "linear", colors = { "red", "blue" }, ] shifted (19cm,10.5cm); StopPage ; \stopMPpage \stoptext

2 2

Question: Are there any ConTeXt aware scientific pulishers yet
by Christoph Hintermüller 19 Apr '20

19 Apr '20

Hi Jet a completely different question just out of curiosity? 1) Does anybody know of any scientific publisher or single journals which accept papers/book chapters typeset in ConTeXt yet 2) If there are any is any of them convinced enought about ConTeXt to recommend use of ConTeXt or even provide template? 3) What would be needed and what could help to make them aware? (difficult to properly formulate, if unclear dont bother) Best Xristoph -- Christoph Hintermueller Eisenhandstraße 33/23 4020 Linz Austria Tel.: +43 650 8827347 mail: christoph(a)out-world.com www: http://www.out-world.com

7 13

Introducing myself
by David van Diepen 19 Apr '20

19 Apr '20

Dear everybody, I don't have a particular question for the moment but I thought it would be nice to introduce myself as I have just joined the email list. My name is David van Diepen, 49 years old. I am a process engineer. I have two children. A few months ago my son had to prepare his thesis and that's when I thought latex would be applicable. Very many years ago I learned to work with latex during my education, so I thought that it wouldn't be too hard to help him out with that. At the end of the day it actually was hard work to get to grisps again but after 10 days we had prepared a very good-looking thesis and that's what counts. In the line of my work I regularly have to prepare technical documents. So I thought it's perhaps a good idea to start using latex for that too. My teamleader has given me some space to do that even though latex is completely unsupported at work, so I'm doing all that from home. The first document was recieved quite wel actually. As you'll probably understand my collegues have difficulty appreciating the value of a properly designed document. Everybody seems to agree to a similar and often poor appearance. I am the son of a graphic designer, so maybe that's why I do care what the documents I produce look like. For instance, I have a couple of nice books with examples of typefaces (letterproeven) lying about that I inherited, these are an inspiration too. Also I think a well designed document conveys the content better. So I'm glad that I am allowed start with this development even though the benefits are very abstract still. That's when I thought whether it would be a good idea to continue investing time in latex, or whether it would be better to go with the new developments, that being the luatex/context combination. So I thought I should at least give it a try. That try was actually harder than I expected. On hindsight I think it could have been easier if I had found the right channels to documentation sooner. There is a lot of information on context to be found but that includes a lot of information that's already superseded. So a couple of times it took me quite some time before I realized there was a newer and easier method. Anyway I'm well on my way now with my first technical ducument in context. The thing I like most about context is that the structure makes good sense. In latex there have been so many additions troughout the years that it has become quite messy really. In the longer run I think the greater array of possibilities is going to pay off for my purposes too. So I would like to thank you all for allowing me to use this great software. I expect that I may post questions in the future because I am planning to try more things. For now it's maybe a good idea if I put some contributions in the wiki. As a newby I have struggled at some points and maybe some howto's with that perspective can be helpful for other newcomers. For now, thanks again, yours faithfully, David

3 2

(no subject)
by Jairo A. del Rio 19 Apr '20

19 Apr '20

I've seen the following solution in Stack Exchange to add referenceable enumeration labels to a framed enumeration environment: https://tex.stackexchange.com/questions/438588/context-and-metafun-framed-e… It uses \wrappedcurrentconstruction. However, it only prints the counter label and the counter name. What if I need the text enclosed by braces in the frame header too? E. g. \starttheorem[thm1]{Residue theorem} so the framed title includes "Residue theorem" also. Thank you in advance.

2 2

lmtx vs mkiv
by Hans Hagen 18 Apr '20

18 Apr '20

Hi, One problem of mixed usage of mkiv (with luatex) and lmtx (with luametatex) is that in the later we use a different (initial) context runner. Basically all platforms are now handled the same (in mkiv there was a stub and no texlua, in unix something shebang with texlua because of argument passing limitations). However, the main context script can be told to use a specific engine: context --luatex foo.tex so in principle one can use both lmtx and mkiv with the same binary tree, given that luametatex and luatex are both present and that luametatex is in charge. For that reason the latest lmtx installer now (for the time being) also includes the luatex binary (plus mkiv files needed) so that one can install lmtx and run both engines. Instead of the --luatex switch one can also force the engine in the usual way with "% engine=luatex" at the top line of the source file (but no pdftex and xetex in this installer). FWIW, the lmtx installation ships with the latest experimental luatex binary but normally that should not have consequences, but it does permits testing occasional updates. Hans ----------------------------------------------------------------- Hans Hagen | PRAGMA ADE Ridderstraat 27 | 8061 GH Hasselt | The Netherlands tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl -----------------------------------------------------------------

3 2

updating mkiv
by Otared Kavian 18 Apr '20

18 Apr '20

Hi all, Is the latest version of ConTeXt mkiv the following: current version: 2020.01.30 14:13 I am asking this because after running sh firstsetup.sh that is what I get. Best regards: OK

2 3

Using two versions of ConTeXt
by Jairo A. del Rio 18 Apr '20

18 Apr '20

Hi everyone! I'm using the ConTeXt version packaged with TeX Live 2020 and recently I have downloaded LMTX. Both of them work, but when I call "context" from terminal, I compile with the TeX Live version, whereas I have to use a fully specified path to get LMTX output. Is there a way to call both from terminal, say, using "lmtx" or other shortcut for the standalone version? I work on Ubuntu 18.04. Thank you in advance.

2 1

"Remember picture" does not work (again)
by Jairo A. del Rio 18 Apr '20

18 Apr '20

I've tried using the fix in https://tex.stackexchange.com/a/492197/193767 in order to make TikX's remember picture feature usable, Code below, just in case: \unprotect% This fixes the present bug\unexpanded\def\pdflastxpos{\numexpr\clf_lastxpos\relax}\unexpanded\def\pdflastypos{\numexpr\clf_lastypos\relax}% This might be needed if you run PGF 3.1.3% see https://github.com/pgf-tikz/pgf/issues/675\def\XC@tgt@mod#1{#1}\def\XC@sdef… picture] \node (A) {Node 1};\stoptikzpicture Hi world\starttikzpicture[remember picture] \node (B) {Node 2};\stoptikzpicture\starttikzpicture[overlay,remember picture] \draw (B) --++(0,0.5) -| (A);\stoptikzpicture\stoptext However, the following appears: l.1 6 120806 \lastxpos ->\clf_lastxpos <write> \noexpand \pgfsyspdfmark {pgfid1}{\the \lastxpos }{\the \lastypos } <inserted text> }\endwrite <argument> \shipoutscratchbox \page_shipout_box #1->\clf_shipoutpage #1 \relax \setbox #1\emptybox \global ... ... l.20 \stoptext I use LuaTeX 1.10 7127 + ConTeXt MkIV 2019.03.21 21:39 (TeX Live version), in case this helps. Is another fix necessary? A Metapost alternative would be fine, too.

3 4

Colors in lmt_surface and luametafun
by Otared Kavian 17 Apr '20

17 Apr '20

Hi Hans, On page 36 of luametafun.pdf there is the following example of using lmt_surface: \startMPcode{doublefun} draw lmt_surface [ preamble = "local sin, cos = math.sin, math.cos", code = "sin(x*x) - cos(y*y)", color = "f, f/2, 1-f", color = "f, f, 0", xstep = .02, ystep = .02, xvector = {-0.4, -0.4}, height = 10cm, lines = true, ] xsized .TextWidth ; \stopMPcode What is the meaning of « f » in « color = "f, f/5, 1-f" »? Is it possible to specify other colors and how can it be done? Thanks for your attention: Otared

2 1

Text around an image
by Fabrice Couvreur 17 Apr '20

17 Apr '20

Hi, I know that this question has been raised several times (especially by me !), but the solutions provided sometimes work and sometimes not, especially in this example. Thanks for your help. Fabrice \useMPlibrary [dum] \define\ItemCommand {\hskip\zeropoint\relax\autoinsertnextspace} \setupitemgroup [itemize] [color=black, style=bold, distance=\zeropoint] \setupitemgroup [itemize:1] [option={n,packed,fit,intext}, command=\ItemCommand] \setupitemgroup [itemize:2] [lefttext=, righttext=, option={a,text}] \starttext \startitemize \startitem Justifier que \m{x>4} et \m{y>2}. \stopitem \placefigure[right,none]{}{\externalfigure [dummy]} \startitem Pour calculer la valeur de \m{y} en fonction de \m{x}, l'urbaniste a écrit la fonction en Python. \startitemize \startitem Son algorithme est-il correct ? \stopitem\par \startitem Programmer une fonction \m{A(x)} qui renvoie l'aire totale du terrain en fonction de la longueur \m{x}. \stopitem \stopitemize \stopitem \startitem On considère la fonction suivante. \startitemize \startitem Qu'affiche l'instruction ? \stopitem\par \startitem Interpréter les résultats renvoyés. \stopitem \stopitemize \stopitem \stopitemize \stoptext

2 2

[LMTX] error updating luametatex
by kaddour kardio 17 Apr '20

17 Apr '20

Hi! my issue is probably only distro related but i was unable to use luametatex after an update from AUR repos in Archlinux. running mtx-run --generate give me this error unknown script 'cache.lua' or 'mtx-cache.lua' -- Dr YAHYAOUI Mohamed Kaddour, cardiologue .

4 5

\startMPcode and \startMPpage
by Jeong Dal 17 Apr '20

17 Apr '20

Hi, The following sample code is working well in the \startMPpage ~ \stopMPpage, but is not working in the \startMPcode ~ \stopMPcode. The error message is \textfont0 is undefined (character 63) l.6 \setstrut\strut $A$ If I remove “$” from the code, it is also working in \startMPcode ~ \stopMPcode. Is there anything which I have to set for \startMPcode? Best regards, Dalyoung %%%%%%%% \startMPcode{doublefun} %\startMPpage numeric count, temp[], tt, minus, u; u := 1cm; path p,q,r; pair A,B,C,D; string varName, ss, pos[]; p := unitsquare xyscaled (8u,3.5u); draw p; pos[0] := "bot"; pos[1] := "rt"; pos[2] := "top"; pos[3] := "lft"; varName := "yxwz"; count := 0; pickup pencircle scaled 5pt; for i = 0 upto 3: drawdot (point i of p); draw lmt_text[ text = "$" & char(65+i) & "$", anchor = pos[i], offset = 2pt, position = point i of p, ]; endfor; %\stopMPpage \stopMPcode

2 2

filtering pages from /PrintPageRange
by Pablo Rodriguez 17 Apr '20

17 Apr '20

Dear list, this is a new experience deep inside LuaMetaTeX (for me). I need to compose a new document from selected pages (which are marked automatically and stored in /PrintPageRange) in a PDF document containing 1000 pages. It has to be one of the worst coding snippets ever written, but it works. It reads the array from /PrintPageRange, deploying it in context.filterpages. \startluacode function document.printrange_from_file(filename) range_array = pdfe.open(filename).Catalog.ViewerPreferences.PrintPageRange for i=1,#range_array do file_page = range_array[i] if file_pagerange == nil then file_pagerange = file_page else file_pagerange = file_pagerange .. " " .. file_page end end for str in file_pagerange:gmatch("([^%s]+)") do add_one = str + 1 if right_range == nil then right_range = add_one else right_range = right_range .. " " .. add_one end end spaces_in_pagerange = right_range:find(' ') local _, spaces_in_pagerange = right_range:gsub(" ", "") for actualspace=1,spaces_in_pagerange do if (actualspace % 2 == 0) then right_range = right_range:gsub(' ',',', 1) else right_range = right_range:gsub(' ',':', 1) end end context.filterpages( { filename }, { right_range }, { width = Opt } ) end \stopluacode \def\filterfrompagerange[#1]{% \ctxlua{document.printrange_from_file("#1")}} \setuplayout[page] \setupinteractionscreen[option={portrait, paper}] \starttext \filterfrompagerange[huge-book.pdf] \stoptext I copied and adapted all from Stackoverflow snippets. It is useful for me, since it file will be changing, page marking is automatic and filtering marked pages will be automatic too. But I wonder whether this may be useful to others. I wonder whether it makes sense to add it to the wiki. Let me know what you think about -- http://www.ousia.tk

1 0

Using command line values in a TeX document; writing a script?
by Gerben Wierda 15 Apr '20

15 Apr '20

Currently, I process a file like this: mtxrun --autogenerate --script context test12.tex and in the file test12.tex one sees something like this: \input archimate-mp \ctxlua{moduledata.archimate(“myarchimatefile.xml")} The latter parses the xml file and produces a PDF using generated MP code. What I would like to do is not have to edit the .tex file when I want to process another .xml file but just pass the name of the xml file on the command line. And I would like to pass on a second filename with some local overrides settings fr my code. All of this needs to be data that I can use in my programming. E.g. something like: mtxrun --autogenerate --script myscriptname “ myarchimatefile.xml” “myhelper.xml" It is OK that this would produce a fixed name output file (e.g. myparsedxml.pdf), so it is OK to have some generic myparsedxml.tex (instead of test12.tex as per my example) file that produces a .pdf and more in the current working directory but resides somewhere in a generic place. But preferably, this would produce myarchimatefile.pdf I’ve read the manual on mtxrun scripts to see if I can make my own, but I’m utterly failing to understand what is written in a way that let me write my own. G

5 8

Lmtx + pgfplots compilation error
by Fabrice Couvreur 13 Apr '20

13 Apr '20

Hi, Still with the idea of using lmtx, I get a compilation error when I use pgfplots. Thank you. Fabrice #################################################### open source > level 9, order 92, name 'pgfplotsbinary.data.code.tex' tex error > tex error on line 42 in file pgfplotsbinary.data.code.tex: ! Undefined control sequence l.42 \catcode`\ =11^^I\expandafter\xdef\csname pgfp@bin@ \the\counter^^I\endcsname{^^20}\endgroup\advance\counter by1 lua error: ? <empty file> The control sequence at the end of the top line of your error message was never \def'ed. You can just continue as I'll forget about whatever was undefined. mtx-context | fatal error: return code: 256 TeX Output exited abnormally with code 1 at Mon Apr 6 22:19:01

3 11

fun with frames and tables
by Henning Hraban Ramm 13 Apr '20

13 Apr '20

Hi, after I re-setup my computer (harddisk got tired...) I’m now trying to update my old Midgard RPG character sheet (https://github.com/fiee/ConTeXt/tree/master/midgard) and run into some problems that I don’t understand while trying to fill one page with several tables. Here’s a quite minimal example: \setupTABLE[c][each][width=2cm] \starttext \framed[offset=overlay,width=\textwidth]{% \vbox{\bTABLE \dorecurse{10}{\bTR\bTD x \eTD\bTD y \eTD\eTR} \eTABLE}% \hskip1cm% \vbox{\bTABLE \dorecurse{10}{\bTR\bTD x \eTD\bTD y \eTD\bTD z \eTD\eTR} \eTABLE}% } \stoptext I’m trying to get those tables side by side, but the size of the wrapping box is somehow miscalculated – if I set the width, the left table disappeares to the left, if I don’t, the box exceeds the paper width. Maybe it’s completely unrelated to the tables. In the full document, there’s also space before or after one of the tables, so that they don’t align. There are actually not just two tables, but a short wide one and a combination of 3*2 small ones on the left side (that’s why I seem to need that \vbox) and a big table on the right side. But I’ll care about the other problems if I understand what’s going on with those boxes. Happy Easter & best regards, Hraban

2 3

offset for background overlay
by mf 13 Apr '20

13 Apr '20

Hello list, this MWE is a simplified version of a real case: \startuseMPgraphic{cell:triangle} path p ; p := unittriangle rotated 90 xscaled 2.5 OverlayWidth yscaled 2.5 OverlayHeight ; draw p withcolor red ; \stopuseMPgraphic \defineoverlay[triangle][{\uniqueMPgraphic{cell:triangle}}] \starttext \bTABLE[frame=off] \bTR \bTD[nx=2,background=triangle,align=middle] \dontleavehmode a\crlf text \eTD \eTR \bTR[toffset=1mm] \bTD left \eTD \bTD right \eTD \eTR \eTABLE \stoptext The triangle is used as background of the 2-column wide cell of the first row. I want the triangle to go around the second row too, as if it were a frame for all the 3 cells. It means that it should be shifted down a bit. So I tried this: \startuseMPgraphic{cell:triangle} path p ; p := unittriangle rotated 90 xscaled 2.5 OverlayWidth yscaled 2.5 OverlayHeight ; draw p shifted (0,-3mm) withcolor red ; \stopuseMPgraphic ... but it does not work, because the content of the background is centered on the cell, so "shifted (0,-3mm)" has no effect. The only solution I found is drawing something above the triangle with a neutral color, so that the whole background is centered in the cell and the red triangle goes down: \startuseMPgraphic{cell:triangle} path p ; p := unittriangle rotated 90 xscaled 2.5 OverlayWidth yscaled 2.5 OverlayHeight ; fill p shifted (0,6mm) withcolor white ; % only to move the next one down draw p withcolor red ; \stopuseMPgraphic \defineoverlay[triangle][{\uniqueMPgraphic{cell:triangle}}] \starttext \bTABLE[frame=off] \bTR \bTD[nx=2,background=triangle,align=middle] \dontleavehmode a\crlf text \eTD \eTR \bTR[toffset=1mm] \bTD left \eTD \bTD right \eTD \eTR \eTABLE \stoptext It's a dirty trick. I'm sure there's a cleaner way. Does anybody know it? Thanks, Massi

3 6

font troubles in MkIV
by Henning Hraban Ramm 13 Apr '20

13 Apr '20

Hi again, as I had to re-setup my computer, I installed all my TeX project fonts in subdirectories of texmf-fonts/fonts/. Most of them are found after one or two forced update runs, strangely not all of them, and ConTeXt won’t load them in the most cases. If I move the same font files to one of the directories in OSFONTDIR, e.g. ~/Library/Fonts, or into the project directory, it works. I don’t see a pattern which fonts are found and which not (except that the only Type 1 font family I tried didn’t work, i.e. only after I installed the TTF version in ~/Libraray/Fonts). I already deleted the luatex cache. Any hints for debugging? (Latest LuaTeX MkIV on macOS 10.14) Best, Hraban

1 0

Project Gutenberg Projects
by Thangalin 13 Apr '20

13 Apr '20

Hi list! Another blog post for you all, tangentially related to ConTeXt: https://dave.autonoma.ca/blog/2020/04/11/project-gutenberg-projects In particular, the conversion from XHTML to Markdown so that pandoc can convert Markdown to ConTeXt may be of interest: https://dave.autonoma.ca/blog/2020/04/11/project-gutenberg-projects/#xhtml-… This is in preparation for part 8 of the typesetting Markdown series, which discusses how ConTeXt can be used to typeset annotations in pandoc's extended Markdown. If there's anything else you'd like to see, let me know. Cheers!

2 1

running lua in metafun and in ConTeXt
by Jeong Dal 12 Apr '20

12 Apr '20

Dear all, The problem is solved by using the namespace of lua as below: I am not sure what I did is the right way. If it is not the right way, please let me know. Thanks for reading. Best regards, Dalyoung \startluacode P={} combi = P function P.fact (n) if n <= 0 then return 1 else return n * P.fact(n-1) end end function P.ncr(n,r) return P.fact(n)/(P.fact(r)*P.fact(n-r)) end combi = { fact = fact, ncr = ncr, } \stopluacode \startbuffer[fig121] numeric n,r,s,u,dx,dy,tt; u := 1.8cm; path p, q; pair A,B,start,now; A := dir(210)*u; B := dir(-30)*u; dy := sind(30)*u; dx := 2*cosd(30)*u; for n=0 upto 4: start := n*dir(210)*u; for r=0 upto n: s := n-r; % tt := lua("mp.print(P.fact(" & decimal n & ")/(P.fact(" & decimal r & ")*P.fact(" & decimal s &" )))"); tt := lua("mp.print(P.ncr(" & decimal n & "," & decimal r & " ))"); now := start+r*right*dx; dotlabel.top(textext("$\displaystyle {" & decimal n & "\choose" & decimal r & "} = "& decimal tt & "$"),now); draw now -- (now+A); draw now -- (now+B); endfor; endfor; \stopbuffer

2 4

\type -- extra space in TABLE
by Tomas Hala 12 Apr '20

12 Apr '20

Hi all, in the following code \starttext \type{6\az12} % \az = \anycommand \bTABLE \bTR\bTD\type{6\az12}\eTD\eTR \eTABLE \stoptext there is a different behaviour of \type: while its parametr in normal text is printed out as is (expected), in the TABLE the extra space is displayed after the command. Is it ok? How could I suppress the extra space? Best wishes Tomáš

2 1

Fontawesome in lmtx
by kaddour kardio 11 Apr '20

11 Apr '20

Hi, if there any changes in the interface for using symbols? I tried today the example from Aditya's Blog but it shows no symbols: \definetypeface[mainfont][rm][specserif][Linux Libertine O][default] \definetypeface[mainfont][mm][math] [TeX Gyre Pagella Math][default] \definetypeface[mainfont][tt][mono] [Dejavu Mono][default] [rscale=0.8, features=none] \setupbodyfont[mainfont,11pt] \usesymbols[fontawesome] \define\FA{\dosingleargument\doFA} \def\doFA[#1]{\inlinedbox {\scale[height=1em]{\symbol[fontawesome][#1]}}} \starttext Checked box \FA[check-square-o] Unchecked box \FA[square-o] \stoptext i use luamtetex for archlinux with all luatex modules linked to lmtx folder -- Dr YAHYAOUI Mohamed Kaddour, cardiologue .

3 5

\placelist[chapter][counter=realpage] not working
by Pablo Rodriguez 11 Apr '20

11 Apr '20

Dear list, here you have the following sample: \setuppapersize[A6] \setupuserpagenumber[way=chapter] \starttext \placelist[chapter][counter=realpage] \dorecurse{5}{\chapter{Chapter}} \stoptext Why doesn’t \placelist[chapter] use the realpage counter? According to i-context.pdf, \placelist inherits from \setuplist (which also inherits from \setupcounter). I really need that, since the document I’m composing needs chapter and part page numbering independent from the whole document page numbering. Am I missing something or have I hit a bug? Many thanks for your help, Pablo -- http://www.ousia.tk

2 2

running lua in metafun and in ConTeXt
by Jeong Dal 11 Apr '20

11 Apr '20

Dear all, I draw Pascal’s triangle with the label of each point created by using lua functions. As you see in the code below, I defined fact(n) and combi(n,r) using lua. For the calculation tt, I used two different methods. Both are working well when I run the given code. But I got an error, when I added this code to a ConTeXt file composed product and components, and using the second method, i.e. combi(n,r). The first method is still working well. The error message is as following: metapost log > loading metafun, including plain.mp version 1.004 for metafun iv and xl metapost log > luatex warning > mplib: run script: [string "return mp.print(combi(0,0 ))"]:1: attempt to call a nil value (global 'combi') metapost log > >> tt metapost log > >> vacuous metapost log > ! Equation cannot be performed (numeric=vacuous). metapost log > <to be read again> metapost log > ; metapost log > <for(0)> ...&decimal(0)&","&decimal(EXPR0)&" ))"); metapost log > now:=start+(EXPR0)*right*d... metapost log > <for(0)> ....now--(now+A);draw.now--(now+B);endfor metapost log > ; ENDFOR metapost log > <*> ...now+A); draw now -- (now+B); endfor; endfor metapost log > ;; I don’t know why the same code treated differently. I think that I have to do something more in luacode which I don’t know. Comments are wellcome! Best regards, Dalyoung %%%%%%% \startluacode function fact (n) if n <= 0 then return 1 else return n * fact(n-1) end end function combi(n,r) return fact(n)/(fact(r)*fact(n-r)) end \stopluacode \startbuffer[fig121] numeric n,r,s,u,dx,dy,tt; u := 1.8cm; path p, q; pair A,B,start,now; A := dir(210)*u; B := dir(-30)*u; dy := sind(30)*u; dx := 2*cosd(30)*u; for n=0 upto 4: start := n*dir(210)*u; for r=0 upto n: s := n-r; % tt := lua("mp.print(fact(" & decimal n & ")/(fact(" & decimal r & ")*fact(" & decimal s &" )))"); tt := lua("mp.print(combi(" & decimal n & "," & decimal r & " ))"); now := start+r*right*dx; dotlabel.top(textext("$\displaystyle {" & decimal n & "\choose" & decimal r & "} = "& decimal tt & "$"),now); draw now -- (now+A); draw now -- (now+B); endfor; endfor; \stopbuffer \starttext \switchtobodyfont[11pt] \processMPbuffer[fig121] \switchtobodyfont[12pt] \stoptext

2 1

Geometric math symbols in Lucida OT
by Tim Steenvoorden 11 Apr '20

11 Apr '20

Hi all, I decided to switch to Lucida OpenType, but now I’ve another problem. In the Type1 variant, all geometric shapes (\square, \triangleright, \blacktriangleright, etc.) had the same size as math operators (\boxplus, \boxdot). This appears not to be the case any more in the OpenType variant, they are way too big! (See attachment.) Pagella and Latin Modern do this right. Is this a font issue or a ConTeXt issue? Anything I can do about this without redefining every symbol I need by hand? Cheers, Tim \startproduct test \setupbodyfont[lucidaot,10pt] $\square\boxtimes$ \stopproduct

1 0

xhtml export internal command \dostarttaging modify display and other XML/XHTML attributes
by Christoph Hintermüller 10 Apr '20

10 Apr '20

Hi I'm helping to make t-vim module fully usable in xhtml and futher epub export. Getting a distingct tag for the individual lines was quiet easy to do using \dostarttagged and \dostoptagged internal macros. What i'm not able to figure are the following things: 1) How can i set/modify the display attribute of the resulting div.myclass section in the generated *_templates.css file. Per default the display attribute is set to "inline" while i need "block" or "flex" (not jet decided" which). 2) How can i predefine the white-space css attribute to pre-wrap 3) Is there a way to tell context to include the resulting class inside the *.default.css or *.styles.css or should that be done via the css parameter of the \setupbackend macro only? Best Xristoph

3 6

mp strings
by Hans Hagen 10 Apr '20

10 Apr '20

Hi, The *next* lmtx upload (one of these days) will have a small extension to the mp library wrt strings. In order to be more " neutral the string can be bound by STX/EOT characters (enabled by default). In addition to that there is also an option to set the catcode regime. The combination of these permits passing and processing strings as-they-are. Just in case the Gerbens among us need it. Hans ==================== example ===================== \startTEXpage \def\foo{x} \framed{\startMPcode interim catcoderegime := vrbcatcoderegime ; draw textext("stream $\string\foo$") withcolor "darkred" ; \stopMPcode} \framed{\startMPcode draw textext("stream $\foo$") withcolor "darkblue" ; \stopMPcode} \startlmtxmode % here the string starts with ascii code 2 (STX) and ends with % ascii code 3 (EOT) ... visibility depends on the editor and % font used; these are normally not used and therefore nice % alternative string capsules \framed{\startMPcode interim catcoderegime := vrbcatcoderegime ; draw textext(stream $\string\foo$) withcolor "darkgreen" ; \stopMPcode} \framed{\startMPcode draw textext(stream $\foo$) withcolor "darkyellow" ; \stopMPcode} \stoplmtxmode \stopTEXpage ----------------------------------------------------------------- Hans Hagen | PRAGMA ADE Ridderstraat 27 | 8061 GH Hasselt | The Netherlands tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl -----------------------------------------------------------------

1 0

METAPOST/MetaFun withtransparency doesn't accept my pair primary argument, what am I doing wrong?
by Gerben Wierda 10 Apr '20

10 Apr '20

I have refactored my code to use withtransparency and separate parameters for colors, sizes, transparency, etc. But I’m running into a problem. The fillTransparency parameter is a pair primary (as can be seen from the show command) Here is a pretty minimum example (in reality there are multiple colors and transparencies passed on): \starttext \startMPpage[instance=doublefun] vardef Foo( expr w, h, fillColor, fillTransparency) = show "FOO:", w, h, fillColor, fillTransparency; save pic; picture pic; save circ; path circ; circ := (fullcircle xyscaled (h,h)); pic := image ( fill (circ shifted (w-h/2,-h/2)) withcolor fillColor withtransparency fillTransparency; ); pic enddef; pic := Foo( 150, 50, (0.686,1.000,1.000), (1,1.000)); draw pic; \stopMPpage \stoptext and the result is: metapost log > >> "FOO:" metapost log > >> 150 metapost log > >> 50 metapost log > >> (0.68600000000000005,1,1) metapost log > >> (1,1) metapost log > ! Missing argument to withtransparency. metapost log > <to be read again> metapost log > ((1,1)) metapost log > <argument> ...0000005,1,1))withtransparency((1,1)) metapost log > ; metapost log > image->...ture;currentpicture:=nullpicture;(TEXT3) metapost log > ;currentpicture.if.str(SUF... metapost log > metapost log > Foo->...)withcolor(EXPR4)withtransparency(EXPR5);) metapost log > ;pic.endgroup metapost log > <*> ...o( 150, 50, (0.686,1.000,1.000), (1,1.000)) metapost log > ; draw pic; ; What am I doing wrong here? Thanks, G PS. Given the complaint about asking both here and on tex.stackexchange, which of the two is the best place?

2 2

Float positioning
by Alexey Kryukov 10 Apr '20

10 Apr '20

Hi all, Suppose I have the following document: \setupexternalfigures[location={local,default}] \starttext \dorecurse{3}{\input{knuth}} \placefigure[top]{cow}{\externalfigure[cow][width=150mm]} \input{knuth} \placefigure[page]{one more cow}{\externalfigure[cow][width=150mm]} \placefigure[page]{cow again}{\externalfigure[cow][width=150mm]} \dorecurse{10}{\input{knuth}} \stoptext Here I would expect the text flow to continue below the first image, and then two more images to be positioned on separate pages. Instead I get no text at all at the page with the Figure 1 and one more blank page after it. Only after the last image the text flow continues. Since similar situations are very common for documents which contain several large illustrations, I would like to know if there are any workarounds for the problem. -- Regards, Alexey Kryukov <anagnost at yandex dot ru> Moscow State University Faculty of History

3 6

using realpagenumber for /PageLabels
by Pablo Rodriguez 09 Apr '20

09 Apr '20

Dear list, I have the following sample: \setupuserpagenumber[way=chapter] \starttext \dorecurse{5}{\chapter{Chapter}} \stoptext I need to restart user page numbers in each part (I use real page to number the complete document). But the main problem is this way also restarts pages in the final PDF document (/PageLabels). Is there any way that I can use real pages instead of user pages for /PageLabels in the PDF document? Many thanks for your help, Pablo -- http://www.ousia.tk

1 0

Why does this example from the MetaFun manual not work?
by Gerben Wierda 09 Apr '20

09 Apr '20

I would like to use the result of transparent() straight in my macros, so I can pass the colors with transparency using a single parameter. That should be possible if I understand the MetaFun manual (where I’ve copy-pasted this example from): \starttext \startMPpage[instance=doublefun] vardef SampleText (expr t, c) = save p ; picture p ; p := image (draw t infont "\truefontname{Regular}") ; draw (p shifted (- xpart center p,0)) scaled 5 withcolor c; enddef ; SampleText ("Much Of This" , transparent(1, .5, red )) ; SampleText ("Functionality" , transparent(1, .5, green)) ; SampleText ("Was Written" , transparent(1, .5, blue )) ; SampleText ("While Listening", transparent(1, .5, cmyk(1,0,0,0))) ; SampleText ("To the CD's Of" , transparent(1, .5, cmyk(0,1,0,0))) ; SampleText ("Tori Amos" , transparent(1, .5, cmyk(0,0,1,0))) ; \stopMPpage \stoptext But it results in: system > files > jobname 'testcolor', input './testcolor', result 'testcolor' fonts > latin modern fonts are not preloaded languages > language 'en' is active open source > level 2, order 3, name './testcolor.tex' fonts > preloading latin modern fonts (second stage) fonts > 'fallback modern-designsize rm 12pt' is loaded metapost > initializing instance 'doublefun:1' using format 'metafun' and method 'double' metapost > loading 'metafun' as '/usr/local/context-osx-64/tex/texmf-context/metapost/context/base/mpiv/metafun.mpxl' using method 'double' metapost > initializing number mode 'double' metapost log > metapost log > loading metafun, including plain.mp version 1.004 for metafun iv and xl metapost log > metapost log > ! Missing ')' has been inserted. metapost log > <to be read again> metapost log > withprescript metapost log > transparent->(1)withprescript metapost log > "tr_alternative="&decimal.transparency_alternat... metapost log > <*> ... ("Much Of This" , transparent(1, .5, red ) metapost log > ) ; SampleText ("Functiona... metapost log > backend > xmp > using file '/usr/local/context-osx-64/tex/texmf-context/tex/context/base/mkiv/lpdf-pdx.xml' pages > flushing realpage 1, userpage 1, subpage 1 close source > level 2, order 3, name './testcolor.tex' close source > level 1, order 3, name 'cont-yes.mkiv' For me, it is not about passing colour on to ConTeXt to typeset text, these are colors that normally would be drawn with “withcolor ca withtransparency (method,factor)” but that requires the passing of many more parameters and a lot more work in coding. Does transparent() maybe produce a string that looks like “ca withtransparency (method,factor)” so something only usable in draw/fill/etc statements? But in that case how does that work without scantokens to parse the string? Is there a way I can do this without having twice the parameters (and I have to pass multiple colours) in my macros everywhere? Thanks, G

4 6

Short weekday option for date command
by Adam Reviczky 08 Apr '20

08 Apr '20

Hi, Is there a way to achieve a short weekday option with \date[] to get 3 letter equivalents (Mon, Tue, Wed, Thu, Fri, Sat, Sun) similar to the monthshort either through context or lua? Thanks, Adam

3 4

Background color of a framedtext that covers floats
by Fabrice Couvreur 08 Apr '20

08 Apr '20

Hi, Is there a more elegant way to have a white background for the table ? In fact, my question is more general : if we insert an image, the background color envelops this image : how to solve this problem ? Thank you. Fabrice \definecolor[fondpaille][c=0,m=0,y=0.2,k=0] \starttext \startframedtext [frame=off,width=\textwidth, background=color,backgroundcolor=fondpaille] \input tufte \startlinecorrection[blank] \startmidaligned \startxtable [align={lohi,middle}, option={stretch},framecolor=cyan, offset=0.8ex,background=color,backgroundcolor=white] \startxrow \startxcell \bf Profondeur \m{x} (en mètre) \stopxcell \startxcell \bf Pression \m{P} (en bar) \stopxcell \startxcell \bf Volume \m{V} (en \m{\text{dm}^{3}}) \stopxcell \stopxrow \startxrow \startxcell 0 (niveau de la mer) \stopxcell \startxcell 1 \stopxcell \startxcell 1 \stopxcell \stopxrow \startxrow \startxcell 10 \stopxcell \startxcell 2 \stopxcell \startxcell 0,5 \stopxcell \stopxrow \stopxtable \stopmidaligned \stoplinecorrection \stopframedtext \stoptext

2 3

Fwd: Using Lua files in project structure
by Jairo A. del Rio 06 Apr '20

06 Apr '20

---------- Forwarded message --------- De: Jairo A. del Rio <jairoadelrio6(a)gmail.com> Date: lun., 6 de abr. de 2020 a la(s) 08:58 Subject: Re: [NTG-context] Using Lua files in project structure To: Wolfgang Schuster <wolfgang.schuster.lists(a)gmail.com> Well, I'll be more specific. I attach a zip file showing a minimal example of what I achieved so far and its output (labelled "Works") and what I actually want, but does not work (labelled "Doesnotwork"). I've tried different commands and combinations, all of them useless. As a side note, I'm porting some TikZ functions. Although it is not recommended in ConTeXt, some of them are really necessary to me. El dom., 5 de abr. de 2020 a la(s) 11:05, Wolfgang Schuster ( wolfgang.schuster.lists(a)gmail.com) escribió: > Jairo A. del Rio schrieb am 05.04.2020 um 17:49: > > None of them work. Maybe I'm doing something wrong. > > I guess so because > > \loadluafile[testh.lua] > > and > > \luaenvironment testh.lua > > work for me. > > Wolfgang >

2 2

Re: [NTG-context] Using Lua files in project structure
by Wolfgang Schuster 06 Apr '20

06 Apr '20

Jairo A. del Rio schrieb am 06.04.2020 um 15:58: > Well, I'll be more specific. I attach a zip file showing a minimal > example of what I achieved so far and its output (labelled "Works") and > what I actually want, but does not work (labelled "Doesnotwork"). I've > tried different commands and combinations, all of them useless. As a > side note, I'm porting some TikZ functions. Although it is not > recommended in ConTeXt, some of them are really necessary to me. You use dofile(...) in your environment and Lua files but this doesn't work when you load files which aren't in the current directory or in your TeX installation. Wolfgang

1 0

startMPpage..stopMPpage written to a separate PDF?
by Gerben Wierda 06 Apr '20

06 Apr '20

I have a series of startMPpage—stopMPpage pairs (with MP code inbetween). These now become separate pages in a single PDF. But I need them to become separate PDF’s each during my ConTeXt run, with a name of my own choosing. Is this possible? I guess this will be problematic, but one can hope (maybe some very low level TeX trickery)... Thanks, G

4 4

Trying to understand this ctxlua error
by Gerben Wierda 06 Apr '20

06 Apr '20

I got this error after I had changed some lua code: tex error > tex error on line 272 in file archimate-lua.new: ! Undefined control sequence warnIfVerbose( "Breaking off the processing of node %s\nNo l...eak xsi:type", node) \luat_start_lua_code_indeed ...ormalexpanded {\endgroup \noexpand \directlua {#1 }} l.272 \stopluacode <empty file> The control sequence at the end of the top line of your error message was never \def'ed. You can just continue as I'll forget about whatever was undefined. I have been looking at that code for over two hours, not seeing anything wrong with it. But I’ve now finally found the culprit and I still do not get it. The culprit was: warnIfVerbose( "Breaking off the processing of %s\n No elementRef", node) The problem goes away when I use: warnIfVerbose( "Breaking off the processing of %s\nNo elementRef", node) (I don’t want the line after the node is printed to begin with a space). But the lack of space between \n and N kills lua (apparently). For completeness (as string.format and texio.write_nl are also in play): function warnWithLabelIfVerbose( str, ... ) if verboseProgram then texio.write_nl( str .. string.format(...)) end end function warnIfVerbose( ... ) warnWithLabelIfVerbose("-----> ", ...) end Is this a lua bug? A ConTeXt bug? Expected behaviour? And if so, why is reported that on line 272 (where \stopluacode is) is the error? Or is the error message indeed helpful and do I just lack the know how to interpret it? G (Took me three hours, this one. Just removing that space that happened with some other changes was the culprit. Totally unexpected for me.)

2 2

Using Lua files in project structure
by Jairo A. del Rio 05 Apr '20

05 Apr '20

I'm writing a project in ConTeXt MKIV and I want to load some (pure) Lua libraries and bindings (defining \ctxlua and the like). For instance, I have the file foo.lua with some macros and I want to use them in my project. Something like this: \startproject project %\component foo.lua %This does not work %\environment foo.lua %This does not work %\input foo.lua %This does not work %\directlua{dofile("foo.lua")} %This does not work even when the project file and foo.lua are in the same folder. \stopproject What should I do? Thank you in advance.

5 6

Bounding box of picture returned by textext() in METAPOST
by Gerben Wierda 05 Apr '20

05 Apr '20

I have this METAPOST macro: vardef makeTeXLabel( expr w, h, name) = if debugProgram or debugLabels: show "NAME makeTeXLabel:", name, tostring 0.8w, tostring 0.8h; fi save p; picture p; p := textext( "\startframedtext[middle]" & "[align=middle,frame=on" & ",width=" & tostring 0.8w & "bp" & ",height=" & tostring 0.8h & "bp]" & name & "\stopframedtext"); save b; path b; b := boundingbox p; save dim; pair dim; dim := (urcorner b) - (llcorner b); save width, height; numeric width, height; width := xpart dim; height = ypart dim; if debugLabels: show "PLACE:", w, h, width, height; fi if (width > 0.8w) or (height > 0.8h): if (width > height): if debugLabels: show "XSCALING:", (0.8w/width,0.8w/width); fi p:= p xyscaled (0.8w/width,0.8w/width); else: if debugLabels: show "YSCALING:", (0.8h/height,0.8h/height); fi p:= p xyscaled (0.8h/height,0.8h/height); fi fi p enddef; It gets called with w=133 and h=53 (I am working in METAPOST native units, so bp) So, the textext() command gets something like 106bp x 42bp, which seems to be the case: metapost log > >> "NAME makeTeXLabel:" metapost log > >> "My 'Application' Function" metapost log > >> "106.40000000000001" cld > tex > w : - : \MPLIBsetNtextX{1}{\startframedtext [middle][align=middle,frame=on,width=106.40000000000001bp,height=42.400000000000006bp]My 'Application' Function\stopframedtext } cld > tex > F : - : \startblankhandling cld > tex > w : - : \setblankcategory{6} cld > tex > F : - : \flushblankhandling cld > tex > F : - : \stopblankhandling metapost log > >> "42.400000000000006" metapost log > >> "PLACE:" metapost log > >> 133 metapost log > >> 53 metapost log > >> 511.08659908200002 metapost log > >> 42.399990514000002 But the bounding box is 511bp wide (something like 7in or 18cm, probably textwidth) but I’m asking for a box that is 106bp wide. What happens here? And how do I get it right? G

1 1

Is there a robust way to find the first (or last intersection) of path p with path q?
by Gerben Wierda 05 Apr '20

05 Apr '20

Intersecting path p and q will give you more or less randomly (actually, there is an algorithm, but not a very useful one for METAPOST) an intersection (time on p, time on q) I am trying to find out if anybody as already created a macro that gives you the intersection with the smallest (or largest) time on p. Probably requires finding all the intersections and then returning either the point on p with minimum (or maximum) t. Before writing myself, maybe someone already has this, in which case thanks in advance. G

1 0

What was that 'rounding paths' metafun(?) function again?
by Gerben Wierda 05 Apr '20

05 Apr '20

I think I saw a function in MetaFun somehwre that you could give a ‘hard’ path, i.e. (0,0) -- (0,1) — (1,1) and it would become a path with nicely rounded (part of a circle) corners (still straight lines), but I can’t find it anymore. I wrote my own, but it is giving me headaches so I’d like to find something that is better than what I produce. G

3 4

Minimum example of problem getting curly braces printed in METAPOST
by Gerben Wierda 05 Apr '20

05 Apr '20

Here is a minimum example of a problem that I have in getting curly braces printed in METAPOST in code that is generated by lua. Any help is welcome. \usemodule[scite] \setupxml [entities=yes] \startluacode function warn( ... ) texio.write_nl("-----> " .. string.format(...)) end local function mpLabelString( xmlLabelString) -- Returns a string where each " is replaced by a METAPOST compatible result, except for outer double quotes" rep = { [1] = { "\"", "\"&ditto&\"" }, -- DOESN'T WORK: [2] = { "\\", "\\\\" }, } local tmpString = string.formatters( "%!tex!", xmlLabelString) warn( "STRING.FORMAT XML \"%s\"", xmlLabelString) warn( "STRING.FORMAT TeX-ed \"%s\"", tmpString) warn( "STRING.FORMAT Replaced \"%s\"", lpeg.replacer(rep):match(tmpString)) return lpeg.replacer(rep):match(tmpString) end function warnAndConTeXt( ...) warn( ...) context( ...) end function moduledata.test( filename) local labelString context( "The string to typeset is:\\par\\type-{Label} \"a\" [Text]!-") context( "\\par The attempts are:") context( "\\par1. \\type-Label Text-") context( "\\par2. \\type-Label [Text]!-") context( "\\par3. \\type-Label \"a\" [Text]!-") context( "\\par4. \\type-{Label} [Text]!-") context( "\\par5. \\type-{Label} \"a\" [Text]!-") context.startMPpage { instance = "doublefun" } context( "picture pic;") labelString = "1. Label Text OK" warnAndConTeXt( "pic := Foo( 0, 0, 150, 50, \"%s\");", mpLabelString( labelString)) labelString = "2. Label [Text]! OK" warnAndConTeXt( "pic := Foo( 0, -75, 150, 50, \"%s\");", mpLabelString( labelString)) labelString = "3. Label \"a\" [Text]! OK" warnAndConTeXt( "pic := Foo( 0, -150, 150, 50, \"%s\");", mpLabelString( labelString)) labelString = "4. {Label} [Text]! MISSING curly braces" warnAndConTeXt( "pic := Foo( 0, -225, 150, 50, \"%s\");", mpLabelString( labelString)) labelString = "5. {Label} \"a\" [Text]! MISSING curly braces" warnAndConTeXt( "pic := Foo( 0, -300, 150, 50, \"%s\");", mpLabelString( labelString)) context( "drawdot (0,0) withpen pencircle scaled 4 withcolor red;") context.stopMPpage() end \stopluacode \usemodule[article-basic] %\enabletrackers[metapost.tracingall,metapost.lua,metapost.runs,metapost.textexts,metapost.scrintersectionPoints,metapost.runs,metapost.graphics,metapost.terminal] \starttext \definefontfamily[mainface][rm][Optima] \setupbodyfont[mainface,10pt] \startMPinclusions[+]{doublefun} \stopMPinclusions \startMPdefinitions{doublefun} vardef makeTeXLabel( expr w, h, name) = show "NAME makeTeXLabel:", name; save p; picture p ; save s; string s; s := "\framed{" & name & "}"; % Curly braces will be missing. I need this to work. % s := "\type-" & name & "-"; % Curly braces are displayed, but this must become a vbox in the end, so can't use it show "SCAN:", s; p := textext( s); p enddef; vardef Foo( expr xpos, ypos, width, height, str) = show "NAME Foo:", str; % Backslashes are already gone here save pic; picture pic; pic := makeTeXLabel( width, height, str) shifted (xpos, ypos); draw pic; pic enddef; \stopMPdefinitions \ctxlua{moduledata.test("My ArchiMate Model Export BES.xml")} \typefile[option=TEX]{test11.tex} \stoptext The question is: how can I get this to work? The strings that have to be printed inside the METAPOST picture come from an XML and can contain about anything. But in the end that string will have to be vertically typeset as a paragraph, hence I cannot use \type (which works).

2 2

splitted xtable with repeating headers and placetable
by Geert Dobbels 05 Apr '20

05 Apr '20

Hello, Code below shows some behaviour I cannot explain (csv file attached): - If I run the code below as is, I get what I want, except that the header line of the table does not repeat at the top of each page. - Changing "split=yes" to "split=repeat" in the setupxtable gives me repeating headers, but the table starts at the second page, leaving the first page with only the text line and all the rest as blank spaces. - Placing the table in a float by activating the 3 commented lines gives me an error ("extra } or forgotten endgroup") pointing to the external figure in my page header overlay. Replacing the \placefigure..... in the page header by ordinary text makes the error go away, but is no solution, since I need the company logo picture there, and even then with no error, the headers do not repeat. - With the table in a float, I manage to get repeating headers when I change to "split=yes" and "headers=repeat" in the \setupxtable, but I still get the abovementioned error as soon as I want to put my figure back in the page header...... Any suggestions ? Geert \usemodule[handlecsv] \opencsvfile{systaprov2.csv} \setuppapersize[A4, landscape] \setuplayout[location=middle, width=27.5cm, height=18cm, backspace=1cm,header=4cm] \setuppagenumbering[state=stop] \setupcaptions[location=none] \setupbackgrounds[header][text][background={Logos}, state=repeat] \setupnumbering [location=] \setupframed[offset=none] \defineoverlay [Logos][{ \framed[width=\textwidth, height=3cm, align=right, strut=no, offset=none, frame=on, frameoffset=0.1cm, corner=round, radius=0.15cm, framecolor=darkgray, background=color, backgroundcolor=gray, framecorner=round, frameradius=0.15cm, rulethickness=0.05cm]{ \framed[width=0.280\textwidth, height=3cm, align=right, frame=off] {\placefigure[force][]{none}{\externalfigure[somepic.png][height=1.9cm]} } \framed[width=0.430\textwidth, height=3cm, align=middle, frame=off] {\crlf\tfa \crlf \bf Technical Report} \framed[width=0.370\textwidth, height=3cm, align=middle, frame=off] {\tfx \crlf Annex T.2.3. \crlf \tfx Date of issue: \crlf \currentdate \crlf page \pagenumber of \lastpage} } }] %\setupfloat[table][default={force,split}] \setupxtable[offset=0cm, frame=off, bottomframe=on, framecolor=gray, option=stretch, split=yes, header=repeat, align=middle] \setupxtable[head][background=color, backgroundcolor=gray, topframe=on, bottomframe=on, framecolor=black, foregroundcolor=blue] \setupxtable[left][align=right] \starttext Some lines of text. This text must come just before the table, but only on the first page of the table \startbuffer[loop] \startxrow \startxcell[left] \cA \stopxcell \startxcell[left] \cB \stopxcell \startxcell[left] \cC \stopxcell \startxcell[left] \cD \stopxcell \startxcell \cE \stopxcell \startxcell[left] \cF \stopxcell \startxcell \cG \stopxcell \startxcell \cH \stopxcell \doifdefined{cI}{\startxcell \cI \stopxcell} \doifdefined{cJ}{\startxcell \cJ \stopxcell} \doifdefined{cK}{\startxcell [left] \cK \stopxcell} \stopxrow \stopbuffer %\startplacetable[] \startxtable \startxtablehead[head] \doloopif{\lineno}{<}{2}{\getbuffer[loop]} \stopxtablehead \startxtablebody \doloopif{\lineno}{>}{1}{\getbuffer[loop]} \stopxtablebody \stopxtable %\stopplacetable \stoptext

3 4

Fontfallbacks using typescripts
by Tim Steenvoorden 04 Apr '20

04 Apr '20

Hi all, I’d like to use Lucida (Type1) as my main font for text and math, but fallback on arrows from Pagella. Especially, I’d like to use the `\downzigzagarrow` which is not defined by Lucida. Although direct lookup of the zigzag symbol in Pagella works, below typescripts do not seem to work. Can somebody give me a hint? Cheers, Tim \startproduct test \definefontfallback[pagellaarrows][texgyrepagella-math][arrows][check=yes,force=yes] \definefontfallback[pagellaarrows][texgyrepagella-math][0x021AF][check=yes,force=yes] \starttypescript[math][main] \loadfontgoodies[lucida-typeone-math] \definefontsynonym[MathRoman][lucidamath@lucida-math][fallbacks=pagellaarrows] \stoptypescript \starttypescript [main] \definetypeface [main] [rm] [serif] [lucida] [default] [features=default] \definetypeface [main] [ss] [sans] [lucida] [default] [features=default] \definetypeface [main] [tt] [mono] [lucida] [default] [features=none] \definetypeface [main] [hw] [handwriting] [lucida] [default] [features=default] \definetypeface [main] [cg] [calligraphy] [lucida] [default] [features=default] \definetypeface [main] [mm] [math] [main] [default]%[fallbacks=pagellaarrows] \stoptypescript \setupbodyfont[main,9pt] $\downzigzagarrow,↯,\downarrow$ {\switchtobodyfont[pagella,10pt]↯} \stopproduct

1 0

Compile a file embedding modules with the lmtx engine
by Fabrice Couvreur 03 Apr '20

03 Apr '20

Hi, I'm sorry but I didn't necessarily follow all the threads. I use to make my graphics Metapost or Metafun, but I also sometimes use TiKz. This file compiles with context but not with lmtx because the modules are not recognized. I am willing to use only lmtx which seems to be the future of ConteXt, but how do I do that ? Thank you. Fabrice \usemodule[tikz] \usetikzlibrary[calc] \starttext \startlinecorrection[blank] \startmidaligned \starttikzpicture \draw[fill=orange!30e,draw=orange] (0,0) rectangle (5,5); \stoptikzpicture \stopmidaligned \stoplinecorrection \stoptext

3 7

xtable headers and handlecsv loop
by Geert Dobbels 03 Apr '20

03 Apr '20

Hello, The sample below has 2 problems I cannot find the solution for: I am reading a table from a CSV file and want to typeset it via \xtable. The xtable as defined below works, it splits over several pages, but the header does not repeat. I have seen examples in the mailing list where people put the "\startxtable.....\stopxtable" within a \placefigure, but as soon as I try this, I get an error message: "missing } or endgroup", although I doublechecked the "}" and I see no error. The other issue I have: Since xtable requires me to read the header line separately in order to put it between \startxtablehead and \stopxtablehead, I access the csv buffer twice: the first time, I only read the first line, and the second time, I read starting from the second line. My problem here is that I do not know beforehand the number of lines in the csv file. So in my second \doloopfromto I give the second argument a number high enough to be sure it reads all the lines. It works fine, but I would like to know if there is a way to read the number of lines in the csv file to use the exact number of lines, instead of guessing. \usemodule[handlecsv] \opencsvfile{systaprov2.csv} \starttext \startbuffer[loop] \startxrow \startxcell[left] \cA \stopxcell \startxcell[left] \cB \stopxcell \startxcell[left] \cC \stopxcell \startxcell[left] \cD \stopxcell \startxcell \cE \stopxcell \startxcell[left] \cF \stopxcell \startxcell \cG \stopxcell \startxcell \cH \stopxcell \doifdefined{cI}{\startxcell \cI \stopxcell} \doifdefined{cJ}{\startxcell \cJ \stopxcell} \doifdefined{cK}{\startxcell [left] \cK \stopxcell} \stopxrow \stopbuffer \setupxtable[offset=0cm, frame=off, bottomframe=on, framecolor=gray, option=stretch, align=middle] \setupxtable[head][background=color, backgroundcolor=gray, topframe=on, bottomframe=on, framecolor=black, foregroundcolor=blue] \setupxtable[left][align=right] \startxtable[header=repeat] \startxtablehead[head] \doloopfromto{1}{1}{\getbuffer[loop]} \stopxtablehead \startxtablebody \doloopfromto{2}{500}{\getbuffer[loop]} \stopxtablebody \stopxtable \stoptext

3 6